Busch Lab

ZMP

tspan9

Ensembl ID:
ENSDARG00000025299
ZFIN ID:
ZDB-GENE-060503-632
Description:
Novel protein similar to vertebrate Tetraspanin family [Source:UniProtKB/TrEMBL;Acc:Q1LXC5]
Human Orthologue:
TSPAN9
Human Description:
tetraspanin 9 [Source:HGNC Symbol;Acc:21640]
Mouse Orthologue:
Tspan9
Mouse Description:
tetraspanin 9 Gene [Source:MGI Symbol;Acc:MGI:1924558]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39192 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23241 Nonsense Available for shipment Available now
sa6503 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39192
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Essential Splice Site 7 241 2 7
ENSDART00000146692 None None 227 None 6
Genomic Location (Zv9):
Chromosome 18 (position 10508608)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11091854
GRCz11 18 11060572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTTATTGTCCATCTGGTATCTGTGGCACATATTGAATGTAGTTGTACA[G/T]ATGTTCCAGAACGCATCAGTATCTGATAATCTGTTCTTTCTGTCTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23241
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Nonsense 40 241 2 7
ENSDART00000146692 Nonsense 26 227 1 6
Genomic Location (Zv9):
Chromosome 18 (position 10508510)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11091756
GRCz11 18 11060474
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTGTGTGGCTGTGGGCTGCTGGGAGTTGGAATCTGGCTGTCTGTTTCT[C/T]AAGGCAGCTTCGCCACCTTCTCCCCCTCCTTCCCCTCTCTCTCCGCTGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4029
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Essential Splice Site 219 241 None 7
ENSDART00000146692 Essential Splice Site 205 227 None 6
Genomic Location (Zv9):
Chromosome 18 (position 10464312)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11047558
GRCz11 18 11016276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCATGCAGTATATGTCATGTTAACCTTTCTCCTGAATTTTGTCATTTC[A/G]GCTCCTGGGAATGGCCTTTTCCATGACACTGTTCCATCAGATCCACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6503
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040500 Essential Splice Site 219 241 7 7
ENSDART00000146692 Essential Splice Site 205 227 6 6
Genomic Location (Zv9):
Chromosome 18 (position 10464311)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11047557
GRCz11 18 11016275
KASP Assay ID:
554-4236.1 (used for ordering genotyping assays)
KASP Sequence:
TGCATGCAGTATATGTCATGTTAACCTTTCTCCTGAATTTTGTCATTTCR[G/T]CTCCTGGGAATGGCCTTTTCCATGACACTGTTCCATCAGATCCACAGAAG
Associated Phenotype:
Not determined