Busch Lab

ZMP

six6a

Ensembl ID:
ENSDARG00000025187
ZFIN ID:
ZDB-GENE-040426-1282
Description:
sine oculis-related homeobox 6a [Source:RefSeq peptide;Acc:NP_957399]
Human Orthologue:
SIX6
Human Description:
SIX homeobox 6 [Source:HGNC Symbol;Acc:10892]
Mouse Orthologue:
Six6
Mouse Description:
sine oculis-related homeobox 6 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1341840]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31940 Nonsense Available for shipment Available now
sa18444 Nonsense Available for shipment Available now
sa16265 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31940
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030646 Nonsense 48 245 1 2
ENSDART00000111763 Nonsense 48 245 2 3
Genomic Location (Zv9):
Chromosome 13 (position 31827919)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31473867
GRCz11 13 31604317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCGCTTTCTCTGGTCACTCCCGGTGGCGCCGTCCGCCTGCGATGTGCTC[G/T]GAAAGAACGAGTCTGTCCTGCGCGCGCGCGCGGTCGTGGCCTTTCACGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18444
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030646 Nonsense 126 245 1 2
ENSDART00000111763 Nonsense 126 245 2 3
Genomic Location (Zv9):
Chromosome 13 (position 31828154)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31474102
GRCz11 13 31604552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTGGACAAGTACCGCGTCCGAAAGAAGTTTCCACTGCCCAGGACGATAT[G/A]GGACGGGGAAYAGAAAACGCACWGCTTTAAGGAAAGAACGCGGCATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16265
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030646 Nonsense 130 245 1 2
ENSDART00000111763 Nonsense 130 245 2 3
Genomic Location (Zv9):
Chromosome 13 (position 31828165)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31474113
GRCz11 13 31604563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCGCGTCCGAAAGAAGTTTCCACTGCCCAGGACGATATRGGACGGGGAA[C/T]AGAAAACGCACWGCTTTAAGGAAAGAACGCGGCATCTGCTGAGAGAGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4513
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030646 Essential Splice Site 191 245 None 2
ENSDART00000111763 Essential Splice Site 191 245 None 3
Genomic Location (Zv9):
Chromosome 13 (position 31828351)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31474299
GRCz11 13 31604749
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTTTAAAAACCGGAGGCAAAGGGACCGAGCGGCAGCGGCCAAGAACAGG[T/C]ACACACATCTCTACCAAACTGCAAAAAGACAGTGTCTTTTTTGTAATTAG
Associated Phenotype:
Not determined