Busch Lab

ZMP

MPP7 (3 of 3)

Ensembl ID:
ENSDARG00000025168
Description:
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) [Source:HGNC Symbol;Acc:26542]
Human Orthologue:
MPP7
Human Description:
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) [Source:HGNC Symbol;Acc:26542]
Mouse Orthologue:
Mpp7
Mouse Description:
membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) Gene [Source:MGI Symbol;Acc:MGI:192

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1890
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081897 Nonsense 113 161 4 5
ENSDART00000081899 Nonsense 113 313 4 9
Genomic Location (Zv9):
Chromosome 2 (position 4369330)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4051583
GRCz11 2 3882472
KASP Assay ID:
554-1880.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTTTGTTATSCTTTTCAGACTCTTCTGTTAGTGCATGATGTGGTGGCG[C/T]AGAAAAGGTTTGACCCTCRGTTGCCGCCTCTGCCCCCTTTACCTGATTRC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5121
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081897 None None 161 None 5
ENSDART00000081899 Essential Splice Site 150 313 5 9
Genomic Location (Zv9):
Chromosome 2 (position 4375623)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4057876
GRCz11 2 3888765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTATCTCTGAATGACAGCTTGAAGAACATCAGCAAACGTGTGTTTTGC[A/T]GGGAGCCACCATAAARARAGACGAGTCGTCTGGAGCTATAATYGYGGCTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25748
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081897 None None 161 None 5
ENSDART00000081899 Essential Splice Site 177 313 5 9
Genomic Location (Zv9):
Chromosome 2 (position 4375708)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 4057961
GRCz11 2 3888850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTATAATCGTGGCTCGGGTCATGAGAGGAGGAGCTGCTGATAGAAGTGG[T/A]GAGTTGCATTGTAATTTATAAATATAATACAGTAAATAGCGCTTAACTCA
Associated Phenotype:
Not determined