Busch Lab

ZMP

si:ch211-157c18.2

Ensembl ID:
ENSDARG00000025108
ZFIN ID:
ZDB-GENE-060503-115
Description:
Novel protein containing a WW domain and PDZ domains (Also known as DHR or GLGF) [Source:UniProtKB/T
Human Orthologues:
MAGI2, MAGI3
Human Descriptions:
membrane associated guanylate kinase, WW and PDZ domain containing 2 [Source:HGNC Symbol;Acc:18957]
membrane associated guanylate kinase, WW and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29647]
Mouse Orthologues:
Magi2, Magi3
Mouse Descriptions:
membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI Symbol;Acc:MGI
membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2451 Essential Splice Site F2 line generated Not yet available
sa41190 Nonsense Mutation detected in F1 DNA Not yet available
sa21277 Essential Splice Site Available for shipment Available now
sa34384 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2451
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064394 Essential Splice Site 94 1076 1 17
ENSDART00000146563 Essential Splice Site 94 1039 1 15

The following transcripts of ENSDARG00000025108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23679658)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22805476
GRCz11 8 22826715
KASP Assay ID:
554-3165.1 (used for ordering genotyping assays)
KASP Sequence:
GTTCTCAACTCATGTCCACATCCCATTCGGATCAAAACCGTCTCTCCAGG[T/G]ACTTTAATCACTGATGAGAGCAAACTGAATATGTGTTTGAAAAAGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41190
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064394 Nonsense 127 1076 2 17
ENSDART00000146563 Nonsense 127 1039 2 15

The following transcripts of ENSDARG00000025108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23672815)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22798633
GRCz11 8 22819872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGGATCCATGGACAGCCAACTCCAACAAGTCATACGGGAGAACCTCTA[C/A]CTGCGCGCCGTGCCCTGTGAGTGATGCAAACATGTTTAATCCAGTACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21277
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064394 Essential Splice Site 173 1076 3 17
ENSDART00000146563 Essential Splice Site 173 1039 3 15

The following transcripts of ENSDARG00000025108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23659884)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22785702
GRCz11 8 22806941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCTCTGGAAGAGTCTGGAGCCTTGCTGGAAAGTGGGAAGTTCAAAGG[T/C]CAGAATCACTGTCTACTTTAAAACCACTTAATGCGTCTAAACTTGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34384
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064394 Nonsense 419 1076 8 17
ENSDART00000146563 Nonsense 419 1039 8 15

The following transcripts of ENSDARG00000025108 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 23642001)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22767819
GRCz11 8 22789058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGTTGTTCTTCGTCGAGGTTACCCCATGCTCTACAACCCTGATGGCTG[C/A]CCCAAAACCAGTCTCGCCTCCCCTTCTGACACACCCAACACCAACCCTGC
Associated Phenotype:
Not determined