Busch Lab

ZMP

fancg

Ensembl ID:
ENSDARG00000024967
ZFIN ID:
ZDB-GENE-050417-103
Description:
fanconi anemia complementation group G protein [Source:RefSeq peptide;Acc:NP_991202]
Human Orthologue:
FANCG
Human Description:
Fanconi anemia, complementation group G [Source:HGNC Symbol;Acc:3588]
Mouse Orthologue:
Fancg
Mouse Description:
Fanconi anemia, complementation group G Gene [Source:MGI Symbol;Acc:MGI:1926471]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20504 Essential Splice Site Available for shipment Available now
sa15941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039369 Essential Splice Site 93 617 3 14

The following transcripts of ENSDARG00000024967 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43115699)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40896964
GRCz11 5 41497117
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTAACCCAAGCGAGATGGAGGAGAGTCTGACCCGCAGTTTATTCAGAG[G/A]TAAGTACAGCAGCGTCGTTTATTGCTCATTTACATGCCGTATTGTGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26540
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039369 Essential Splice Site 248 617 None 14

The following transcripts of ENSDARG00000024967 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43117811)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40899076
GRCz11 5 41499229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTTGGCACATATCCACACTCTTACAGGCCAGACTTTTGCTAAGCTGG[T/A]AAGAAGCTCTGTTCTGCAATCGCCAAACCGATGAACCCTGAGCAAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15941
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039369 Nonsense 273 617 7 14

The following transcripts of ENSDARG00000024967 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 43119093)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 40900358
GRCz11 5 41500511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTATAGGAAGGCAKTGGAGGTAGATTTTTCTTGTCTTGGYGCACTTTA[T/A]CAAAGTGCTCTGGTGTTCAGACAGCTTGGCAATCCAAAGGCWGAAATGGA
Associated Phenotype:
Not determined