Busch Lab

ZMP

spast

Ensembl ID:
ENSDARG00000024933
ZFIN ID:
ZDB-GENE-040426-2331
Description:
Spastin [Source:UniProtKB/Swiss-Prot;Acc:Q6NW58]
Human Orthologue:
SPAST
Human Description:
spastin [Source:HGNC Symbol;Acc:11233]
Mouse Orthologue:
Spast
Mouse Description:
spastin Gene [Source:MGI Symbol;Acc:MGI:1858896]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa19591 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19591
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035150 Nonsense 563 570 17 17
Genomic Location (Zv9):
Chromosome 1 (position 51531161)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50378040
GRCz11 1 51021839
KASP Assay ID:
2259-1117.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGGAGCGTCAGTCCGCAGACCTTGGATCAGTACGTGCGCTGGAACCGC[G/T]AGTACGGAGACACGACTGGCGTATGACAACACGCGCTTCAACCACAGATG
Associated Phenotype:
Not determined