Busch Lab

ZMP

mxc

Ensembl ID:
ENSDARG00000024789
ZFIN ID:
ZDB-GENE-030721-7
Description:
Interferon-induced GTP-binding protein MxC [Source:UniProtKB/Swiss-Prot;Acc:Q6DKF0]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa400 Nonsense Available for shipment Available now
sa41459 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15389 Essential Splice Site Available for shipment Available now
sa16589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa400
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Nonsense 54 626 1 11
Genomic Location (Zv9):
Chromosome 9 (position 33846313)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33002259
GRCz11 9 32813005
KASP Assay ID:
554-0263.1 (used for ordering genotyping assays)
KASP Sequence:
TGAAAAGGACCTGAACCTGCCTGCTATTGCTGTCATCGGTGACCAGAGCT[C/A]AGGAAAGAGTTCAGTGCTGGAAGCCCTGTCTGGAGTGGCGCTGCCGCGGG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa41459
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Essential Splice Site 217 626 4 11
Genomic Location (Zv9):
Chromosome 9 (position 33844546)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33000492
GRCz11 9 32811238
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTGAAGATGGCATCCACAGTCGACCCAACTGGACAAAGGACTTTATG[T/C]ATGTTACGTTACATGTACAGTAGGCTGATATTTTGCTAAATTCAATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15389
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Essential Splice Site 447 626 9 11
Genomic Location (Zv9):
Chromosome 9 (position 33841821)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32997767
GRCz11 9 32808513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTWGAGGACCTGGAAGAACCTGCTTTAAAGCTGCTTAGAAATGCCAAAG[G/A]TTGAWAACAATGTTTAATAGCAAACAAAATGTAGCACCTTTAAAAACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16589
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012694 Nonsense 561 626 11 11
Genomic Location (Zv9):
Chromosome 9 (position 33839739)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32995685
GRCz11 9 32806431
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTGYAGATTGCCTGTGAGCGTCTGGCTAACCAGATTCCRCTGATAGTC[C/T]AGTATCACATGATGAACGAGTACAACTCTCAGCTTCAGAATGCAATGCTT
Associated Phenotype:
Not determined