Busch Lab

ZMP

dpp6b

Ensembl ID:
ENSDARG00000024744
ZFIN ID:
ZDB-GENE-070705-88
Description:
dipeptidyl-peptidase 6 [Source:RefSeq peptide;Acc:NP_001108594]
Human Orthologue:
DPP6
Human Description:
dipeptidyl-peptidase 6 [Source:HGNC Symbol;Acc:3010]
Mouse Orthologue:
Dpp6
Mouse Description:
dipeptidylpeptidase 6 Gene [Source:MGI Symbol;Acc:MGI:94921]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa25100 Nonsense Mutation detected in F1 DNA Not yet available
sa14761 Essential Splice Site Available for shipment Available now
sa19693 Essential Splice Site Available for shipment Available now
sa31263 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Nonsense 282 857 8 26
ENSDART00000132122 Nonsense 282 821 8 25
Genomic Location (Zv9):
Chromosome 2 (position 12235047)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12760272
GRCz11 2 12443058
KASP Assay ID:
554-7403.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACAGGCAGTCTGGGGGTCATATTTAATGGACTTGCTGACTGGCTCTA[T/A]GAAGGTAAAACCCATAAACATTAATAATAAAAACAACACAGTGGACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14761
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Essential Splice Site 410 857 11 26
ENSDART00000132122 Essential Splice Site 410 821 11 25
Genomic Location (Zv9):
Chromosome 2 (position 12224655)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12749880
GRCz11 2 12432666
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCTCAATTCTGACCTTATGTGAGGCCACTACTGGCATCTGCACAAAGG[T/G]AACTGGCAATCAGCCTTATTCACTAKTTTAAACATTTTACAATAATARTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19693
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Essential Splice Site 490 857 15 26
ENSDART00000132122 Essential Splice Site 454 821 14 25
Genomic Location (Zv9):
Chromosome 2 (position 12217381)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12742606
GRCz11 2 12425392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTGGTAATGTAACAATAATAGATATTTATGACAACAATGTCTTTGCA[G/A]ATACTTTTTGAGCACAGAAGACGGTGCAAGTCGGCGTCAGCTTTACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31263
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Nonsense 559 857 17 26
ENSDART00000132122 Nonsense 523 821 16 25
Genomic Location (Zv9):
Chromosome 2 (position 12212403)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12737628
GRCz11 2 12420414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCCAGGTCCCGGTGTGCCTCACTCAGCCGTGTACAGCACCAGATATGGA[C/T]AGTATGAGAGTGAGTCTTCTGTTTCTTACTGCACTTAAACACTATCAGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3400
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037848 Essential Splice Site 784 857 24 26
ENSDART00000132122 Essential Splice Site 748 821 23 25
Genomic Location (Zv9):
Chromosome 2 (position 12202668)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12727893
GRCz11 2 12410679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGCAACTGAGAGASAAGAAACTTATGATAATTCACCCTACAGCCGACG[G/A]TAAACTTGACAGGTTTATTTCTTAAATATATTATGTTMTTAAAACAATTT
Associated Phenotype:
Not determined