Busch Lab

ZMP

selenbp1

Ensembl ID:
ENSDARG00000024717
ZFIN ID:
ZDB-GENE-040426-1436
Description:
Selenium-binding protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6PHD9]
Human Orthologue:
SELENBP1
Human Description:
selenium binding protein 1 [Source:HGNC Symbol;Acc:10719]
Mouse Orthologues:
Selenbp1, Selenbp2
Mouse Descriptions:
selenium binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:96825]
selenium binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:104859]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa4676 Nonsense F2 line generated Not yet available
sa22914 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28709
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030795 Nonsense 12 457 2 12
ENSDART00000131694 Nonsense 12 473 2 12
Genomic Location (Zv9):
Chromosome 16 (position 40804947)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38189747
GRCz11 16 38139779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTTTGTGTGCTTGCAGCTTCAACCTGTTCAGGATGTGGTCCGGGATA[T/G]AAAACCCCTCTGGATGCAATGAAAGGCAAGTAGATTTTCTTTAAAAATGC
Long Flanking Sequence:
TGAGAGAGATTATATCTTTCTTTCTTTCTTTCTTTCTCTTTTTTTATTTTCTTTCTTTCTTTCTTTCTTTTTTGCTTGGTCATTGCAGGGATTGCCCCTTATGTAACCCATAAATATTTTTCTTACAAGCAGGGGAAGGATGTGCAACAATTCTTGGCAAGACACTGAGTCTTCTAGATTGTAACATTACCCATCTGTTGAAGTTGGCTTGTGTGTGTGTTTCTTTCAAGCTTTTATAGAGTAGAAAAAAATGTAGTTCACTTGAAAATAAATCATGCCTTTTAATAACAAACACAAATTGAAGACTCACAATCATGTGATGCACGATAAAAAAACCTTCAGTTAGACTTTATTATAGTTTAAATACTTTAACAAGATTTGTGTTCGAATTGATCTCAGAAACACCTGCTTCAGTTTTTGATTGTCTTACATTATGATATCTGAGATTTACCATTTTGTGTGCTTGCAGCTTCAACCTGTTCAGGATGTGGTCCGGGATA[T/G]AAAACCCCTCTGGATGCAATGAAAGGCAAGTAGATTTTCTTTAAAAATGCATAAGATAATGTGTATATCATGCATGTAAATATGACACAGTATTGCACAGTCATTACAAAACAGCAGTGACCTTTACCCAGGAAATTGAGCTTTATTATCACTGTAAGATCTGATGCAAGCTCCTCCTTACCACTAGAGGTCATCCTCACATTCAGATTGACATATTTCTGCTGTTTTTTTCTTTTTTTTTTCCTTTCGTCATGCAGAAACAGTACTTTTTTATTGTAGTATTTAGAAACATAGTACAAGAGAATACATCTCACAACAGTTATGAACATAATAAAAATAAATAAAATAAAATGAAATAAATGCTTTCATCCAGAAACAGTAATGTTTTATATCTGGTCTTTTGATATTACTAAATCTTATGTTGGCAAAACCAGTTTTACTATAAATACCAAGAGTAATAATAAGGCTATTCATACCATTCTCCAAAGGGAGATTATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4676
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030795 Nonsense 220 457 6 12
ENSDART00000131694 Nonsense 220 473 6 12
Genomic Location (Zv9):
Chromosome 16 (position 40813429)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38198229
GRCz11 16 38148261
KASP Assay ID:
554-3528.1 (used for ordering genotyping assays)
KASP Sequence:
AATGGGGAGCGCCTAAAGCACWGGGAAATGGCTTCWACCCTGCTGACGTC[A/T]AAGCTGGTATGTGCGCATTCAAGAGTGTTCTGTGAAGAGATGGCAGTGGT
Long Flanking Sequence:
GGTGTGGAAAGTTTTTAAATAACTGGCTAAAATTAAAATACAGCTAGAAATTTAACAAACTGTAGTCCTCTGCTTTCCACTCAAGTGGGCGGAGTAATACACAAGGGTGACGAGGCTGTACTAGTGCTGATATTACTTTAATATCTCACGGCTATCAGCCAATCAGATTCGAGAACCAGACAGAATCTTGTATAAACTGCAATACAGCATGTCTCCCTCTTCTACTTGTGGTCCAGTTGACCAAAATGTTTCTTAATAGGTGTAAACATGGCCTGTGTGCTTACTAAAAATGCTAATTAGGCTAATTTGGCATTTTATTGTAAGGCGGTTTTGTGTTGCTGGATGGCGAGACGTTTGAAGTTATTGGTAACTGGGAGCAGCCAGGAGACGCGGCGCCGTTTGGTTATGACTTTTGGTACCAGCCTCGCCACAACGTCATGATCAGCACTGAATGGGGAGCGCCTAAAGCACTGGGAAATGGCTTCAACCCTGCTGACGTC[A/T]AAGCTGGTATGTGCGCATTCAAGAGTGTTCTGTGAAGAGATGGCAGTGGTGATAATGGGTGTTTGTAGGTCACTATGGTCAGCGGCTCCACGTCTGGGACTGGACCACACACAAGCGCATTCAGACTCTGGATTTGGGGGAAGAGGGCGCTATTCCTCTAGAGGTCCGCTTTCTGCATGACCCGGCCGCGGCTGAGGGGTTTGTGGGCTGTGCACTTCAGAGCACCGTCTTCCGCTTCTATAAGACTCCGGCAAGTGTATAAAAAAGCCTTACAACTGTTTTAGTTTGCTTGTGTGTGTATGTTTATGTGTGTGTGGGTGTATACAGTGGCGGAAATAAGTATTGAACACGTCACATTTTTTCCTGGGAATAATAATTCTAAAGGAGCTGTTGACATGAAATTGAACCAGATTTTGTTGAAAACTCTACAAAAATAAAAAAATATGAATGAGTTTGTATTTTCTATTGGATTCAAGTCAGGTGATTGGCTGGGCCATTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7802
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030795 Nonsense 432 457 12 12
ENSDART00000131694 Nonsense 448 473 12 12
Genomic Location (Zv9):
Chromosome 16 (position 40822185)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38206985
GRCz11 16 38157017
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACGGATACAGGAGGCCTAAAACTCAACGAGAATTTCCTTGTGGATTTC[G/T]GAGCGGAGCCAGAAGGTCCTGCACTCGCYCAKGAGCTCCGGTATCCTGGC
Long Flanking Sequence:
AGTGTACAAACTCACAGATCACCCAAAACTGAAGTATACTCACCCTTCACTTGTTACAGACCGGTTTATGTTTCTTTCTTCTGTTGAACAAATAAGAAAGTATTTTAAAGAATGTTAGAAATCAGCAGCACTTTGACCTCCAGTAGCCTTTATTTTTATTCAACTGAAGTCAATGTTTACCAGTTTGCATCATTCTCCATCATTCTCATTCACAAACAGAAAGAAAAAAAACTCTGTATTTGGTGAGGACATTGTCATCGTTTTTGGGTGATCTTTTTGAAACAAAGTTGTGATCCCTTTATGAAAACAATTCTAGTAAAAAAAAAATGAGTCCATTCTGACCCAAATGCTTTATGAAGGTTGAATAGTTTCAAAAATTTGTTTATAATGCTGCAATATCCTTCTTCATTCGCTGCAGGGAGGGTTCGGTCATGATGCAGATTGACGTGAACACGGATACAGGAGGCCTAAAACTCAACGAGAATTTCCTTGTGGATTTC[G/T]GAGCGGAGCCAGAAGGTCCTGCACTCGCCCATGAGCTCCGGTATCCTGGCGGAGACTGTACTTCTGATATCTGGCTATAAAGCTTGGAGCAAACCATGTCGTTCCAAGTTGAAGAGTTATTATTCCTCAGATACATCGTCATTATTATGATCACGTTTAGTTTTTGTGTGGAGCAAATCATATAACACAAACTAATTTCCATCATCTTTGTGTAACATCTATTACTATTATCAAAATGAATACCAAACTATTTGTAAAATAAATTTTTTGTATTCCAGTGAACTCTTTGGATTTGTCAGGTGTTTTTGAAAGGCTTTCAGAATCATTAGAATTGCAAAGTAGATTTTAAACATGTTATGCAAGTGCACAGAAAGAGGACAAACTTTCATCATTACCATAAGCATACATATTTTATTGTTTCAAACAATCTAATATAAAGCCATTATGATGTGTTTTGGGTTTCAAAAAGAGAACAGTGCTTAAAAATTAACTGAACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22914
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030795 Nonsense 446 457 12 12
ENSDART00000131694 Nonsense 462 473 12 12
Genomic Location (Zv9):
Chromosome 16 (position 40822229)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38207029
GRCz11 16 38157061
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTCGGAGCGGAGCCAGAAGGTCCTGCACTCGCCCATGAGCTCCGGTA[T/A]CCTGGCGGAGACTGTACTTCTGATATCTGGCTATAAAGCTTGGAGCAAAC
Long Flanking Sequence:
CTTCACTTGTTACAGACCGGTTTATGTTTCTTTCTTCTGTTGAACAAATAAGAAAGTATTTTAAAGAATGTTAGAAATCAGCAGCACTTTGACCTCCAGTAGCCTTTATTTTTATTCAACTGAAGTCAATGTTTACCAGTTTGCATCATTCTCCATCATTCTCATTCACAAACAGAAAGAAAAAAAACTCTGTATTTGGTGAGGACATTGTCATCGTTTTTGGGTGATCTTTTTGAAACAAAGTTGTGATCCCTTTATGAAAACAATTCTAGTAAAAAAAAAATGAGTCCATTCTGACCCAAATGCTTTATGAAGGTTGAATAGTTTCAAAAATTTGTTTATAATGCTGCAATATCCTTCTTCATTCGCTGCAGGGAGGGTTCGGTCATGATGCAGATTGACGTGAACACGGATACAGGAGGCCTAAAACTCAACGAGAATTTCCTTGTGGATTTCGGAGCGGAGCCAGAAGGTCCTGCACTCGCCCATGAGCTCCGGTA[T/A]CCTGGCGGAGACTGTACTTCTGATATCTGGCTATAAAGCTTGGAGCAAACCATGTCGTTCCAAGTTGAAGAGTTATTATTCCTCAGATACATCGTCATTATTATGATCACGTTTAGTTTTTGTGTGGAGCAAATCATATAACACAAACTAATTTCCATCATCTTTGTGTAACATCTATTACTATTATCAAAATGAATACCAAACTATTTGTAAAATAAATTTTTTGTATTCCAGTGAACTCTTTGGATTTGTCAGGTGTTTTTGAAAGGCTTTCAGAATCATTAGAATTGCAAAGTAGATTTTAAACATGTTATGCAAGTGCACAGAAAGAGGACAAACTTTCATCATTACCATAAGCATACATATTTTATTGTTTCAAACAATCTAATATAAAGCCATTATGATGTGTTTTGGGTTTCAAAAAGAGAACAGTGCTTAAAAATTAACTGAACATATGTTATTATTTTACATCCAGTTATTATTGAGGGGTATTTTTCTAA
Associated Phenotype:
Not determined