Busch Lab

ZMP

si:dkey-204f11.59

Ensembl ID:
ENSDARG00000024708
ZFIN ID:
ZDB-GENE-040724-220
Description:
solute carrier family 25, member 23 [Source:RefSeq peptide;Acc:NP_001038417]
Human Orthologues:
SLC25A23, SLC25A41
Human Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 [Source:HGNC Symbol;A
solute carrier family 25, member 41 [Source:HGNC Symbol;Acc:28533]
Mouse Orthologues:
Slc25a23, Slc25a41
Mouse Descriptions:
solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23 Gene [Source:MGI Symb
solute carrier family 25, member 41 Gene [Source:MGI Symbol;Acc:MGI:2144215]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20065 Nonsense Available for shipment Available now
sa40107 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5213
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030530 Essential Splice Site 104 478 3 11
ENSDART00000145859 Essential Splice Site 109 481 2 10
Genomic Location (Zv9):
Chromosome 3 (position 34307790)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34092986
GRCz11 3 34222494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAAAGAGCTCCGACTCATGTTCAGCAGCCTGGACCACAACAACGATGG[T/C]CTGCATTAACCTTTTATATTAAAATGTAATTACCACACAGTATATGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20065
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030530 Nonsense 324 478 9 11
ENSDART00000145859 Nonsense 327 481 8 10
Genomic Location (Zv9):
Chromosome 3 (position 34312933)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34098129
GRCz11 3 34227637
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTTCTGTTTCTCAGGTGTTGAAGACCCGTTTGACCCTTCGGAAGACT[G/T]GACAGTATTCTGGCATGGCAGACTGTGCCAAGCAGATACTGCGTAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40107
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030530 Nonsense 374 478 10 11
ENSDART00000145859 Nonsense 377 481 9 10
Genomic Location (Zv9):
Chromosome 3 (position 34315416)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34100612
GRCz11 3 34230120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAAAGTATATCTATAACCCTGTTCTCTCAGACACTGAAGAACGCTTG[G/A]CTCCAGCGGTACTGTATGGGCTCGGCTGATCCAGGAGTTCTGGTGCTGCT
Associated Phenotype:
Not determined