Busch Lab

ZMP

zgc:158838

Ensembl ID:
ENSDARG00000024642
ZFIN ID:
ZDB-GENE-041111-123
Description:
hypothetical protein LOC492549 [Source:RefSeq peptide;Acc:NP_001082822]
Human Orthologue:
PIP5K1A
Human Description:
phosphatidylinositol-4-phosphate 5-kinase, type I, alpha [Source:HGNC Symbol;Acc:8994]
Mouse Orthologue:
Pip5k1a
Mouse Description:
phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha Gene [Source:MGI Symbol;Acc:MGI:107929]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22761 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22761
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020859 Nonsense 159 584 6 16
Genomic Location (Zv9):
Chromosome 16 (position 11342614)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9857664
GRCz11 16 9748566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCCTTGATCGAACTGTCCAATCCTGGAGCAAGCGGATCCATCTTTTA[C/A]GTGACCAGCGATGATGAGTTTATTATTAAAACAGTCATGCACAAAGAGGC
Long Flanking Sequence:
AGACTAACTGAAAAGTAATGTTTCAATTAAATGGTGTAAATGAATCAGATTTAGTTTAAATGTACATACTGTCACCTGGCAATGCAGAGGGTTTGGTGAGCAAATAAAGGCAAAGGCAGATTCTGCTTAACTAGTGTATTCAGCATTTAAATCCACTGTGTTATACATGTAATTGTTTTTATTACAATAAAAGTTAATACTTCATTAGTAAATACGATTTAAAGTTATGCTTTTCTTTATATTATAATATTGTTATGAAGTAAATTAGGAAATTACCCATGTCAACTTTAATGTAGTTTAGTTTGGTATATTTACCTTTGGCCCACGGCTCTCAATGATATTTGGTTTTTTAGCCCTTAATATGAAAAGGTTTGCGGACGCCTGCTTTAGAGACACTCCTGATGTGTTTGTTTTGTGTCTTCTTGCTTTCTGCAGTACTCGCTGTGTAACGATCCCTTGATCGAACTGTCCAATCCTGGAGCAAGCGGATCCATCTTTTA[C/A]GTGACCAGCGATGATGAGTTTATTATTAAAACAGTCATGCACAAAGAGGCAGAGTTCCTGCAGAAACTACTGCCTGGGTACTTCATGGTGAGCAATAAGCACTTGTGTATTTTAGAATTTTTGAAAATGTGGACGACAACAAACTCTCCTTTGATAGTTCTGTATGAAAAAAGAACTAAATATTAAGAACAGAACAGTAATGCATGTTTTAATCCAAAATGACAGCTTTTGTTTATGATATTCTTTACTCTTTCCTCTCTTAGAACCTGAATCAGAACAAAAGAACGCTGCTCCCAAAGTTTTATGGCTTGTATTGCGTTCAGGCGGGTGGAAAGAACATCCGTATCGTTGTTATGAATAATCTGTTGCCTCGCAGTGTGCCTATGCACCTCAAATATGACCTGAAGGGCTCAACATACAAGCGGCGTGCCTCTCCTAAAGAGAGAGACAAGAGTGTGCCCACTTACAAAGACTTGGATTTCATTCAGGACATGCCAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2885
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020859 Nonsense 233 584 7 16
Genomic Location (Zv9):
Chromosome 16 (position 11343012)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9858062
GRCz11 16 9748964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGTTATGAATAATCTGTTGCCTCGCAGTGTGCCTATGCACCTCAAATA[T/A]GACCTGAAGGGCTCAACATACAAGCGGCGTGCCTCTCCTAAAGAGAGAGA
Long Flanking Sequence:
CTGATGTGTTTGTTTTGTGTCTTCTTGCTTTCTGCAGTACTCGCTGTGTAACGATCCCTTGATCGAACTGTCCAATCCTGGAGCAAGCGGATCCATCTTTTACGTGACCAGCGATGATGAGTTTATTATTAAAACAGTCATGCACAAAGAGGCAGAGTTCCTGCAGAAACTACTGCCTGGGTACTTCATGGTGAGCAATAAGCACTTGTGTATTTTAGAATTTTTGAAAATGTGGACGACAACAAACTCTCCTTTGATAGTTCTGTATGAAAAAAGAACTAAATATTAAGAACAGAACAGTAATGCATGTTTTAATCCAAAATGACAGCTTTTGTTTATGATATTCTTTACTCTTTCCTCTCTTAGAACCTGAATCAGAACAAAAGAACGCTGCTCCCAAAGTTTTATGGCTTGTATTGCGTTCAGGCGGGTGGAAAGAACATCCGTATCGTTGTTATGAATAATCTGTTGCCTCGCAGTGTGCCTATGCACCTCAAATA[T/A]GACCTGAAGGGCTCAACATACAAGCGGCGTGCCTCTCCTAAAGAGAGAGACAAGAGTGTGCCCACTTACAAAGACTTGGATTTCATTCAGGACATGCCAGAGGGCATCCAGCTGGAGCCAGACAACTACAATGCACTCTGCAAAACTATCCAGCGGGACTGCCTGGTGAGCATGCATGTCTGGGGGTGTGTGATATCGCATGCTAGTTTTAGAATTATAAATATGGTGATGATTTTGATTAGTGCTGTGCACAATATATAGCATTATTCAAACTTTGATGGTTGGTAAGAACTTTTTGTTGTTCATTCTATTCACTAAAGTCTGTATTTAAAACAACAAAACAGTCATTACTCTAGTCTTTATTGTCACAGAAATCTTCCCAGAATTATTCTATTGATCTGATTGGTGCTCATGTGATGCATTTTTCAATATTCTTTGATTAATACATCAAAATAATAGCAGTTTTAAAAATAATAGTAATACAATAGCAGTCTAATGTG
Associated Phenotype:
Not determined