Busch Lab

ZMP

c6ast3

Ensembl ID:
ENSDARG00000024503
ZFIN ID:
ZDB-GENE-050320-99
Description:
six-cysteine containing astacin protease 3 [Source:RefSeq peptide;Acc:NP_001013544]
Human Orthologue:
ASTL
Human Description:
astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
Mouse Orthologue:
Astl
Mouse Description:
astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40959 Nonsense Mutation detected in F1 DNA Not yet available
sa38629 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27003
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030900 Essential Splice Site None 254 1 9
ENSDART00000114934 Essential Splice Site None 255 1 10
Genomic Location (Zv9):
Chromosome 7 (position 40036644)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38373284
GRCz11 7 38644542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATAAAATAAGTTGCCCCATGAACTTTAAGGTACTGAGGTGAGAATAGTG[G/T]TAAGTTTTTCATTGTTTATATTGTTTACAACGAAAGAAAGGTATTAAATG
Long Flanking Sequence:
TTGATATTATTGTAGTTTTTGTTTGCAAAAAATAATGCAGAGTCAGTCTGACTTTAATAGTCTGAATTCTTCTGATAAATCCAGCTTCTGTATCAGGAGCTGCATACTTAAAATAGACTGCATTAGTATTCAGTGTCCGACGGGTACATAAAAGTGTGTGTTGATTAACAGAATATGAAATAAGAATAATAATACTCTTCTTATTCTATAATTCTTACAGTTTTTTATTAAAGGGGCCAGGGTACATTCCTAAAAAAATGTTTCTTGAGGTTTACACTTTCCCTTTGTCCAAAAACTCACATACAATACAGTTTTAAAGCTTTCGTAAGAGTTGTTTTTGACATGTGCTCCTGTGAGGGGAACTGCACACCTGTTCTTTTTCAAACAAGGTTAAACAAACTCTTTTGCCCATATTTGTAAAGATCATTTTGATACTAACTCCCACCGGAGTATAAAATAAGTTGCCCCATGAACTTTAAGGTACTGAGGTGAGAATAGTG[G/T]TAAGTTTTTCATTGTTTATATTGTTTACAACGAAAGAAAGGTATTAAATGGAAACTTGAATAGGTTGGGTGCCATTTAATAAGGTTATGGTGTACAAGTATACTTTTTATTTTACAATTATATATTATTATTATTATTATTATATTTTTTATGAATTATAATGAATTCAGTTCAATACCCAGATTTCTCATGACAAACTTATCTGTGATCTGTAAATTCTGTTCCCTGATCCCCTCCACAGGTCTCTGGACACCATGTTTGTGACAAAAGTGACTTTTGGCCTTTTGGCCCTGATGTTGGTCTACTCAGCTGAAGGAAAGGTAAAACAATCATTTGTACACACCTATAAAAATTTGTAAACGATGCATGGTTTTGTATACTATAATATAAAATAATATGCAAAAAATGTTTTGACATTACCTAATATTTATTATCCATTTTGTGTTGGGTGTTCTGGCATAACTCACATCCAGCCTGGTAAGTGAAATGCCTAATTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40959
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030900 Nonsense 64 254 4 9
ENSDART00000114934 Nonsense 65 255 5 10
Genomic Location (Zv9):
Chromosome 7 (position 40035797)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38372437
GRCz11 7 38643695
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGACGACATTGCTGTGAATGAGAAAAATGCTGATCCCTGCACCTCCTA[C/A]GGCTGTCTCTGGCCCAAATACAGTGATGGCAAGATTTATGTGCCTTACGT
Long Flanking Sequence:
TAAAAATTTGTAAACGATGCATGGTTTTGTATACTATAATATAAAATAATATGCAAAAAATGTTTTGACATTACCTAATATTTATTATCCATTTTGTGTTGGGTGTTCTGGCATAACTCACATCCAGCCTGGTAAGTGAAATGCCTAATTTAGCTACTTACCTAATTTAGCAAAGAGAATGTAAAAGCGTTTTAGAAGAAACAAATGAAACAACAAATATTGAGATTTTCTTTTTAACTGAAGCAATGGTTCATTGGTGAATGTGTTGACTTGTTTTTTATAATAGCTCAGCTGTCTGTGTCTGAACTGCTGCATAGAGCCAACAGAGGCATCAGTGCGTATACAACACTTACTCAGCAATACACATCAGTATATCTCAACTGTTCATTACTGAAAGACCCAAAATGACCTGTTCATGTTTTAGTTCCTGAAGCTGATGAGCCCAAGCTCCTGGACGACATTGCTGTGAATGAGAAAAATGCTGATCCCTGCACCTCCTA[C/A]GGCTGTCTCTGGCCCAAATACAGTGATGGCAAGATTTATGTGCCTTACGTCATCGCCAACCACTACTGTAAGTCATTAATTACACAGAAAAAAAGTAGGCCAAATACAGAACTCTTGCTGAATGCATGAAAATGCCTTTAGAATGCTAAATTAAAGGGACAGTTCACAAACAAAAAGACAATTCTGTCACATTCACCCCCACTTATAAACCTGAATTACTTTTTCTCCTGTCAAACACAAAAGAAAAGATTTGTAAACCGGTAACCATCGACTTACATCAACATTACTCAAAATATCTTCTCTTGTGTTTAACAGAAAAACAAAACTCATTCTCTCGGATTCCATTAATAATGAAAAAAAATTACCTTTTCATAGTAGCAACCTCTGACTTTTGCCCTTTCAGCCTCCCGTGAGCTGGAGATCATCCAGCGTGGACTGGACTCTTTCTCTTACAGTACTTGTATCCGCTTCTTCCCTCGCGGCAATGAGAGAGACTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38629
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030900 Essential Splice Site 86 254 4 9
ENSDART00000114934 Essential Splice Site 87 255 5 10
Genomic Location (Zv9):
Chromosome 7 (position 40035729)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38372369
GRCz11 7 38643627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACAGTGATGGCAAGATTTATGTGCCTTACGTCATCGCCAACCACTACT[G/T]TAAGTCATTAATTACACAGAAAAAAAGTAGGCCAAATACAGAACTCTTGC
Long Flanking Sequence:
CATTACCTAATATTTATTATCCATTTTGTGTTGGGTGTTCTGGCATAACTCACATCCAGCCTGGTAAGTGAAATGCCTAATTTAGCTACTTACCTAATTTAGCAAAGAGAATGTAAAAGCGTTTTAGAAGAAACAAATGAAACAACAAATATTGAGATTTTCTTTTTAACTGAAGCAATGGTTCATTGGTGAATGTGTTGACTTGTTTTTTATAATAGCTCAGCTGTCTGTGTCTGAACTGCTGCATAGAGCCAACAGAGGCATCAGTGCGTATACAACACTTACTCAGCAATACACATCAGTATATCTCAACTGTTCATTACTGAAAGACCCAAAATGACCTGTTCATGTTTTAGTTCCTGAAGCTGATGAGCCCAAGCTCCTGGACGACATTGCTGTGAATGAGAAAAATGCTGATCCCTGCACCTCCTACGGCTGTCTCTGGCCCAAATACAGTGATGGCAAGATTTATGTGCCTTACGTCATCGCCAACCACTACT[G/T]TAAGTCATTAATTACACAGAAAAAAAGTAGGCCAAATACAGAACTCTTGCTGAATGCATGAAAATGCCTTTAGAATGCTAAATTAAAGGGACAGTTCACAAACAAAAAGACAATTCTGTCACATTCACCCCCACTTATAAACCTGAATTACTTTTTCTCCTGTCAAACACAAAAGAAAAGATTTGTAAACCGGTAACCATCGACTTACATCAACATTACTCAAAATATCTTCTCTTGTGTTTAACAGAAAAACAAAACTCATTCTCTCGGATTCCATTAATAATGAAAAAAAATTACCTTTTCATAGTAGCAACCTCTGACTTTTGCCCTTTCAGCCTCCCGTGAGCTGGAGATCATCCAGCGTGGACTGGACTCTTTCTCTTACAGTACTTGTATCCGCTTCTTCCCTCGCGGCAATGAGAGAGACTACATCAGCATTGAATCTCGCAGCGGGTACGTGACAGATCTTAAACCTAATGCAAAGAGACAACACAAAAGTC
Associated Phenotype:
Not determined