Busch Lab

ZMP

gnpda2

Ensembl ID:
ENSDARG00000024443
ZFIN ID:
ZDB-GENE-091117-41
Human Orthologue:
GNPDA2
Human Description:
glucosamine-6-phosphate deaminase 2 [Source:HGNC Symbol;Acc:21526]
Mouse Orthologue:
Gnpda2
Mouse Description:
glucosamine-6-phosphate deaminase 2 Gene [Source:MGI Symbol;Acc:MGI:1915230]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24951 Nonsense Mutation detected in F1 DNA Not yet available
sa13521 Essential Splice Site Available for shipment Available now
sa42338 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24951
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Nonsense 28 277 1 6
ENSDART00000136474 Nonsense 28 277 2 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 4517018)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 4169880
GRCz11 14 4276859
KASP Assay ID:
554-7747.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCAGCGAATGGGCTGCAAAGTACATCCGCAACCGGATCATCCAGTTC[A/T]AACCCAGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGGTAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13521
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Essential Splice Site 42 277 None 6
ENSDART00000136474 Essential Splice Site 42 277 None 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 4516974)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 4169924
GRCz11 14 4276903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGTTCAAACCCAGTGCTGACCGCTACTTCACTTTAGGACTTCCAACAGG[T/G]AAATTGAACGTGTAAARTCAGCATTTTACCCTGCTTTGTTAGGAAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42338
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038301 Nonsense 95 277 3 6
ENSDART00000136474 Nonsense 95 277 4 7

The following transcripts of ENSDARG00000024443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 4514787)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 4172111
GRCz11 14 4279090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGAGATCATCCAGAGAGCTATCACTCCTACATGTGGAATAACTTCTTC[A/T]AGCACATCGACATTGAACCCCAAAACACTCATATACTGGACGGCAACGCC
Associated Phenotype:
Not determined