Busch Lab

ZMP

twistnb

Ensembl ID:
ENSDARG00000024416
ZFIN ID:
ZDB-GENE-041007-3
Description:
DNA-directed RNA polymerase I subunit RPA43 [Source:UniProtKB/Swiss-Prot;Acc:Q6PHG8]
Human Orthologue:
TWISTNB
Human Description:
TWIST neighbor [Source:HGNC Symbol;Acc:18027]
Mouse Orthologue:
Twistnb
Mouse Description:
TWIST neighbor Gene [Source:MGI Symbol;Acc:MGI:106292]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23410 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23410
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038422 Nonsense 217 387 4 5
ENSDART00000127578 Nonsense 220 390 4 4
Genomic Location (Zv9):
Chromosome 19 (position 2308385)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2215944
GRCz11 19 2397848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATTTGTCGTCGGCTTTCAGAGTGCAGGAGCTCGTGGCCCAATTTGAA[C/T]AAAAACAAGTGACTGCAGAATCAAGCACAGAAGCAGACGCCACAGAAGAC
Associated Phenotype:
Not determined