Busch Lab

ZMP

arhgap1

Ensembl ID:
ENSDARG00000024324
ZFIN ID:
ZDB-GENE-050417-305
Description:
rho GTPase-activating protein 1 [Source:RefSeq peptide;Acc:NP_001017781]
Human Orthologue:
ARHGAP1
Human Description:
Rho GTPase activating protein 1 [Source:HGNC Symbol;Acc:673]
Mouse Orthologue:
Arhgap1
Mouse Description:
Rho GTPase activating protein 1 Gene [Source:MGI Symbol;Acc:MGI:2445003]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa38631 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38631
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036461 Nonsense 295 434 10 13

The following transcripts of ENSDARG00000024324 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 40171424)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38508064
GRCz11 7 38779322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGGGAATATTCCGGCGTTCTGCTAATGTTTCTTTGGTGAAGGATGTT[A/T]AGGCAAAATATAACTCAGGTAAAATCATGAAATGCCCTGTGTAGTTTGCT
Associated Phenotype:
Not determined