Busch Lab

ZMP

adh8b

Ensembl ID:
ENSDARG00000024278
ZFIN ID:
ZDB-GENE-030529-2
Description:
alcohol dehydrogenase 8b [Source:RefSeq peptide;Acc:NP_982285]
Human Orthologues:
ADH1A, ADH1B, ADH4, ADH6, ADH7
Human Descriptions:
alcohol dehydrogenase 1A (class I), alpha polypeptide [Source:HGNC Symbol;Acc:249]
alcohol dehydrogenase 1B (class I), beta polypeptide [Source:HGNC Symbol;Acc:250]
alcohol dehydrogenase 4 (class II), pi polypeptide [Source:HGNC Symbol;Acc:252]
alcohol dehydrogenase 6 (class V) [Source:HGNC Symbol;Acc:255]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide [Source:HGNC Symbol;Acc:256]
Mouse Orthologues:
AC079845.1, Adh1, Adh4, Adh6a, Adh6b, Adh7
Mouse Descriptions:
alcohol dehydrogenase 1 (class I) Gene [Source:MGI Symbol;Acc:MGI:87921]
alcohol dehydrogenase 4 (class II), pi polypeptide Gene [Source:MGI Symbol;Acc:MGI:1349472]
alcohol dehydrogenase 6 (class V), pseudogene 1 (Adh6-ps1), non-coding RNA [Source:RefSeq DNA;Acc:NR
alcohol dehydrogenase 6A (class V) Gene [Source:MGI Symbol;Acc:MGI:1916367]
alcohol dehydrogenase 6B (class V) Gene [Source:MGI Symbol;Acc:MGI:2446626]
alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene [Source:MGI Symbol;Acc:MGI:87926]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7717
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042766 Essential Splice Site 6 376 2 10

The following transcripts of ENSDARG00000024278 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12514700)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12513068
GRCz11 13 12645543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGCATTCANNNCAGCAATACGACTACACTGGGAAATGGCCACTGCAGGGAAG[G/A]TTCGTAAACTTGTCTTTTGGTCTGTTTTCATTTGTGCTGCAGAGCAGTTC
Associated Phenotype:
Not determined