Busch Lab

ZMP

zgc:65870

Ensembl ID:
ENSDARG00000024276
ZFIN ID:
ZDB-GENE-040426-2122
Description:
poly(rC)-binding protein 4 [Source:RefSeq peptide;Acc:NP_998282]
Human Orthologue:
PCBP4
Human Description:
poly(rC) binding protein 4 [Source:HGNC Symbol;Acc:8652]
Mouse Orthologue:
Pcbp4
Mouse Description:
poly(rC) binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1890471]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa39380 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39380
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104693 Essential Splice Site 267 442 12 14
ENSDART00000137945 Essential Splice Site 289 464 11 13
Genomic Location (Zv9):
Chromosome 22 (position 35121600)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 32361297
GRCz11 22 32315921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGAGTCCAGCTCCCAGACAGCATCACAAGAACTTCTCATTCCAAATGAC[G/A]TAAGTGCTAAAACTTTTCTTTGCAAGTATCCTATTACTCATGATCCTAAC
Associated Phenotype:
Not determined