Busch Lab

ZMP

si:ch211-63o20.5

Ensembl ID:
ENSDARG00000024195
ZFIN ID:
ZDB-GENE-041001-193
Description:
hypothetical protein LOC566703 [Source:RefSeq peptide;Acc:NP_001038580]
Human Orthologue:
ZNF395
Human Description:
zinc finger protein 395 [Source:HGNC Symbol;Acc:18737]
Mouse Orthologue:
Zfp395
Mouse Description:
zinc finger protein 395 Gene [Source:MGI Symbol;Acc:MGI:2682318]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa17836 Essential Splice Site Available for shipment Available now
sa37100 Nonsense Mutation detected in F1 DNA Not yet available
sa39292 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17836
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034332 Essential Splice Site 71 387 2 9
ENSDART00000148066 Essential Splice Site 71 387 3 10
Genomic Location (Zv9):
Chromosome 20 (position 34774268)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34846781
GRCz11 20 34749660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAAACCTAATGTCCTTCCCAAGGTCTTCCGGCATGGAYTTACCTTACAG[G/A]TTAACATGCACAYCCATTTAATCTCTGYWGTATGTTGTCYTACCAAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37100
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034332 Nonsense 127 387 4 9
ENSDART00000148066 Nonsense 127 387 5 10
Genomic Location (Zv9):
Chromosome 20 (position 34771784)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34844297
GRCz11 20 34747176
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTGTGGAGGTGATCTATCTGACAGTGGCAGCAGTGGTTACTGGAGTT[G/A]GGACCATGGAAATGTAAGCCCAGCCCCGTCTCCATCGGTCAATGAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39292
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034332 Essential Splice Site 311 387 7 9
ENSDART00000148066 Essential Splice Site 311 387 8 10
Genomic Location (Zv9):
Chromosome 20 (position 34767421)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34839934
GRCz11 20 34742813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACATTTTGCAGCTGGACTCCGCCTGGAGACGTCCAGCAGAAACCTCAG[G/A]TTAGTCTGATATCCACAAGCACTCCTCATCTTAAAGTGTATTAAGAACCT
Associated Phenotype:
Not determined