Busch Lab

ZMP

mamdc1

Ensembl ID:
ENSDARG00000024017
ZFIN ID:
ZDB-GENE-030616-360
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q7ZZ84]
Human Orthologue:
MDGA2
Human Description:
MAM domain containing glycosylphosphatidylinositol anchor 2 [Source:HGNC Symbol;Acc:19835]
Mouse Orthologue:
Mdga2
Mouse Description:
MAM domain containing glycosylphosphatidylinositol anchor 2 Gene [Source:MGI Symbol;Acc:MGI:2444706]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa9344 Nonsense Mutation detected in F1 DNA Not yet available
sa28871 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4714
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 384 957 7 17
Genomic Location (Zv9):
Chromosome 17 (position 28520975)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28444902
GRCz11 17 28461865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGCTCATGTTTAGCTGGCTGAAGAAYGGCCGTCCTCTCCGCAGCTCA[G/T]AGCGCATGGTCATTACCCAGACTGACCCGGACGTCGCCCCAGGAACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9344
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 428 957 7 17
Genomic Location (Zv9):
Chromosome 17 (position 28521107)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28445034
GRCz11 17 28461997
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTTTGGCACGTACACCTGTGTGGCCTCGCTGAAGAACGGTGGKATACCA[G/T]AGATTAGCATAGACGTCAACATCTCCYCCACCACGGGTGAGTTTTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033943 Nonsense 637 957 10 17
Genomic Location (Zv9):
Chromosome 17 (position 28564797)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28488724
GRCz11 17 28505687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATTCTTTTTTTTATTTTAGGTAAAGCATTTGCTCCTGAGTTCTTTTA[T/A]GATACCTACAGCGCACTGTGGCAAAACAAACCTCGTGTCTACGGCTTCAA
Associated Phenotype:
Not determined