Busch Lab

ZMP

skila

Ensembl ID:
ENSDARG00000023933
ZFIN ID:
ZDB-GENE-070912-548
Description:
Novel protein similar to vertebrate SKI-like oncogene (SKIL) [Source:UniProtKB/TrEMBL;Acc:B0S6E7]
Human Orthologue:
SKIL
Human Description:
SKI-like oncogene [Source:HGNC Symbol;Acc:10897]
Mouse Orthologue:
Skil
Mouse Description:
SKI-like Gene [Source:MGI Symbol;Acc:MGI:106203]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1602 Essential Splice Site Available for shipment Available now
sa15718 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1602
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056522 Essential Splice Site 7 674 2 8
ENSDART00000140498 None None 421 None 3
ENSDART00000141214 None None 153 None 3
Genomic Location (Zv9):
Chromosome 2 (position 37073367)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37370077
GRCz11 2 37352534
KASP Assay ID:
554-1543.1 (used for ordering genotyping assays)
KASP Sequence:
CTGTGWATGGATATGGCCAGCCCTCAGACAGGTCTRAAAACCCCTTTTAA[A/T]GACCTGACCTCATTTAAAGGCAACATGAAGMGGCTGTACAGGGAGCGACT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5154
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056522 Nonsense 281 674 2 8
ENSDART00000140498 Nonsense 269 421 1 3
ENSDART00000141214 None None 153 None 3
Genomic Location (Zv9):
Chromosome 2 (position 37072542)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37369252
GRCz11 2 37351709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCACCAGTGTCTTGGCAAGTGCCAAGGCCTGTTTGTGCCCCATTTCTA[C/A]GTCCAGCCGGATGCCCCTTGCATTCAGTGCATGGAGTGCCAGCTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15718
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056522 Nonsense 610 674 7 8
ENSDART00000140498 None None 421 None 3
ENSDART00000141214 Nonsense 102 153 2 3
Genomic Location (Zv9):
Chromosome 2 (position 37031007)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37327717
GRCz11 2 37310174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCAGCYGGAGCACCGGCTCGAGCAGCTCAAACAGCAGAGTTGCGCCTG[T/A]CAGCCTAAAGAGCAGGAGGCACAGTACAAWGCACAGGTAAATGCATATCT
Associated Phenotype:
Not determined