Busch Lab

ZMP

stk24b

Ensembl ID:
ENSDARG00000023878
ZFIN ID:
ZDB-GENE-040426-2841
Description:
serine/threonine-protein kinase 24 [Source:RefSeq peptide;Acc:NP_998642]
Human Orthologue:
STK24
Human Description:
serine/threonine kinase 24 [Source:HGNC Symbol;Acc:11403]
Mouse Orthologue:
Stk24
Mouse Description:
serine/threonine kinase 24 (STE20 homolog, yeast) Gene [Source:MGI Symbol;Acc:MGI:2385007]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8224
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090316 Essential Splice Site 98 420 3 11
Genomic Location (Zv9):
Chromosome 6 (position 12439834)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12293056
GRCz11 6 12527914
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTATGGATCATCATGGAGTATTTAGGCGGTGGATCTGCCCTAGATTTGG[T/A]ATGATGCAGGACNNTTTTTTTCTCTTKATAAACCCTATATAGTGCAATGTT
Long Flanking Sequence:
AGGGAGAAAGAGAGACGCACAAAGCATTTGTAACAGCAAGATGAAAGAACACACAGAACTTTGTAGCTCCACTGTGGCGAACCATTAGGTGCAATAAATTAATCGCTCCCTTTTAAGAAGCGCTCAGAGTGCTTCTTCATTTTCAGTCGACACACACACACACACACACACACACACACACACACACAGGTTCATGCTCTCTCACTCTTAAGCTCATCATGTGAGGTGGGAGGTATGTAACCCAATTTTCACTCTCTCTCAGTCTAGCTAATCCCAAATTAAAGGAGAGATTAGGATTATACCTCTACCCTCTCACTAGCAAATACCCCGGCTCCTCGAAAATAAGTTGTTGTTTGTTTGTTTTGTTTGTGAGTTGGACTTTTCTTGCCTTTTGACACTCAGTTTCACTAATTCCTCTCTTCATCTCTTTCTCTTGCTGTAGGACACAAAGTTATGGATCATCATGGAGTATTTAGGCGGTGGATCTGCCCTAGATTTGG[T/A]ATGATGCAGGACTTTTTTTTCTCTTGATAAACCCTATATAGTGCAATGTTTCTCTAAAGGAATACTCCACTTTTTCTGAAATGATCTCATTTTACAAGTTCCCTGGAATTTAACAGTGGAGTTTTACAGTTTTTAATACGTTCACCCCATTTCCGGGTTTGGAGGGAGCACTTTTAGCTTAGCTTAGCATAAATAATTGAATCGGATTAGACCATTAGCATCTTGCTAAAAAAAAAAACAAAAAAAAAGGATTTTGATATTTTTTTATGTTAATTTAAGCTTGATATTATGCCATTTCATATTTATTCTATTTCATATTGATGCTGATATTATAGTACTTCAGGCGCTACCGCCATAGACCCTATATAGCGCAATGTTTCTATAAAAGAACACTCCACTTTTTTTTGAGAAATCTTATTTTACAAGTCCCTTGGAGTTAAATAGTGGAGTTTTAAAGTTTTTAATACGTTCAGCTGGTTTCTCGGTGTGGATGGAGCACT
Associated Phenotype:
Not determined