Busch Lab

ZMP

NP_001096041.1

Ensembl ID:
ENSDARG00000023797
Description:
ryanodine receptor 1b (skeletal) [Source:RefSeq peptide;Acc:NP_001096041]
Human Orthologue:
RYR1
Human Description:
ryanodine receptor 1 (skeletal) [Source:HGNC Symbol;Acc:10483]
Mouse Orthologue:
Ryr1
Mouse Description:
ryanodine receptor 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:99659]

Alleles

There are 26 alleles of this gene:

Allele Name Consequence Status Availability
sa8908 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8832 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44894 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8792 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13194 Essential Splice Site Available for shipment Available now
sa39208 Nonsense Mutation detected in F1 DNA Not yet available
sa23341 Nonsense Available for shipment Available now
sa10230 Essential Splice Site Available for shipment Available now
sa23340 Nonsense Available for shipment Available now
sa43145 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14191 Nonsense Available for shipment Available now
sa14094 Essential Splice Site Available for shipment Available now
sa43144 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23339 Nonsense Available for shipment Available now
sa45643 Nonsense Mutation detected in F1 DNA Not yet available
sa44893 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23338 Nonsense Available for shipment Available now
sa6529 Nonsense Mutation detected in F1 DNA Not yet available
sa9444 Nonsense Available for shipment Available now
sa2983 Nonsense F2 line generated Not yet available
sa36692 Nonsense Available for shipment Available now
sa23337 Nonsense Available for shipment Available now
sa39207 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8908
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
GRCz11 18 35652387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8832
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
GRCz11 18 35652387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44894
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz11 18 35652387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAAGAGAAGGG[T/A]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8792
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5
ENSDART00000036015 Essential Splice Site 362 5060 None 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
GRCz11 18 35652387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13194
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 880 5060 21 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33973879)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35653647
GRCz11 18 35632495
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACCTASTGTTGGATACCTTCNNNNNAAAATGAATAAAYGTGAACTCTCTTTCA[G/A]TTCAGGGATGATAATAAGAAGTTGCACCCGTGTCTRGTGGACTTTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39208
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1020 5060 24 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33967327)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35647095
GRCz11 18 35625943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCGTCTGGTGCCTTACAATTTGCTAGACGAGAGAACCAAGAAGACCAAC[C/T]GAGACAGTGTGAACAATGCTGTACGCACTTTGATTGGTTACGGATATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1066 5060 25 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33965873)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35645641
GRCz11 18 35624489
KASP Assay ID:
2261-2415.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGATGTGCATGGAGATAAAGTGAGAATCTTCAGGGCAGAGAAGCAGTA[T/A]GGTGTTACCTCAGGAAAATGGTATTTTGAGTTCGAGGCTGTAACTACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10230
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 1113 5060 25 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33965730)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35645498
GRCz11 18 35624346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTGAGCTTGGTTCTGATGAGTTGGCCTATGTCTTCAATGGAAACAGGG[T/G]CAGTATTGTCATACTTTTATATWYCAGGCAATCCACCTTTCAARATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23340
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1247 5060 28 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33959261)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35639033
GRCz11 18 35617881
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGACCTTCTTAATTGCTATCATTGAACCTTTAGGTCTCTCGTGTGGAT[G/T]GAACTGTAGACAGTGCTCCCTGTATAAAAATTACCCACAAGACGTTCGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4760
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1254 5060 28 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33959238)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35639010
GRCz11 18 35617858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAACCTTTAGGTCTCTCGTGTGGATGGAACTGTAGACAGTGCTCCCTG[T/A]ATAAAAATTACCCACAAGACGTTCGGATCCCAAAACGCCAACACTGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43145
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 1403 5060 30 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33956612)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35636384
GRCz11 18 35615232
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTCTAGTTTTCTCTGTTAAGTATCTTTCTCCCTCTGTGTCCATTGTGC[A/T]GTACTATTACTCGGTTCGTATCTTCGCTGGACAAGAGCCTAGCGAGGTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5639
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 1456 5060 30 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33956448)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35636220
GRCz11 18 35615068
KASP Assay ID:
554-3617.1 (used for ordering genotyping assays)
KASP Sequence:
GTACGGTTACAGTGACAGTTGGAGACGACAAAGGCAACATACATGACAGG[T/C]GAGATCACATAAAAAAATTCGGTTCACACTAGTCTGCTGTGCCTGCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14191
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 1527 5060 32 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33952604)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35633161
GRCz11 18 35612009
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGCCCAACACTAAGCTCTTTCCAGCTGTGTTTGTTCTTCCAAGCAGC[C/T]AAAACATGCTCCAGCTGGAACTTGGAAAACTCAAGGTCAGCGCATCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14094
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 2049 5060 37 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33944614)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35625171
GRCz11 18 35604019
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGCGAGAAACCCACAACAATTTCCACAATGACCTCCTGAATCACTGTGG[T/A]MAGTGTTGACAGTTTTCCTCAGTTGCTTTGATACTTTTCKTATGTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43144
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 2303 5060 42 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 None None 2712 None 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33937662)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35618219
GRCz11 18 35597067
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACAACAATGAGCTGGCACTGGCCCTGCAAGAGCAAGACCTTGAAATGG[T/A]ATTATTAAAATACATTTGTCTTGTTTGCAGAATAAATAAAAATTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23339
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 2432 5060 45 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 84 2712 2 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33934199)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35615041
GRCz11 18 35589887
GRCz11 18 35591888
GRCz11 18 35593889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCACGAAGAGAATAGATTACATCTTGGAAATGCTATTATGTCATTTTA[T/A]TCTGCCCTTATTGACTTGCTGGGTCGCTGTGCTCCTGAGATGCATGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45643
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 2789 5060 53 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 441 2712 10 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33927248)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35608090
GRCz11 18 35582936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCCGTCTTTCAGATCCAAAACAACTGGACATACGGAGAGGTTCTAGAT[G/T]AGAACGCAAAAACTCACCCCATGCTGCGGCCTTATAAAACTTTCTCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44893
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Essential Splice Site 2881 5060 56 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Essential Splice Site 533 2712 13 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33924041)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35604883
GRCz11 18 35579729
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTAAGACTGTATGAAACAAAAACTGACTGATTTACTGTTCTGTGTTCA[G/A]TCTATGGCAGAACAGCTTGCAGAGAACTACCACAACACCTGGGGCCGCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4043
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 3234 5060 66 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 886 2712 23 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33909356)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35590198
GRCz11 18 35565044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACGAGTTCAACTCATACTCTGTGTACACTACCAAAACCCCACGAGAG[A/T]GAACAAGTCAGTAACTCACTCAAAACATATCACATTAACAGTCTATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23338
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 3314 5060 67 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 966 2712 24 61
ENSDART00000146076 Nonsense 38 215 1 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33906509)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35587351
GRCz11 18 35562197
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAACTTCCCAGAGCAGGAAGGCTGTCTGTGCACCGACGTCACCTCCGAA[C/T]AACTCAATCAACTCCTGGGAAGCATCATGAAGATTGTCGTCAACAACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6529
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 3727 5060 78 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 1379 2712 35 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33889068)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35569910
GRCz11 18 35544756
KASP Assay ID:
554-4276.1 (used for ordering genotyping assays)
KASP Sequence:
TGWTCTCCTCACTGCAGCAAACTTGAAGTGGATCATCTATATATGTCATA[T/A]GCTGATATTATGGCAAAAGTAAGTACATAAACGTWTYTTTTGATACCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9444
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 3757 5060 79 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 1409 2712 36 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33888895)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35569737
GRCz11 18 35544583
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAYGAAGGGGGAGAGGAGGGGGGCGTGGAGCCATCCTTTGAGGTGCGA[C/T]WGACAGAGATGGTATGGGGGGGCCTGGGGCTGGGGCCATGGGAGTCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2983
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 4164 5060 89 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 1816 2712 46 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33854555)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35535397
GRCz11 18 35510243
KASP Assay ID:
554-3338.1 (used for ordering genotyping assays)
KASP Sequence:
CACCAACCTGTCTGAGCATGTTCCTCATGACACTCGCTTGCAGAACTTCT[T/A]GGAACAAGCTGAGAGTGTGCTCAACTACTTCCGCCCCTTCCTGGGCCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36692
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 4180 5060 89 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 1832 2712 46 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33854508)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35535350
GRCz11 18 35510196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTGGAACAAGCTGAGAGTGTGCTCAACTACTTCCGCCCCTTCCTGGGC[C/T]GAATCGAGATCATGGGTGCTAGCAAAAGGATTGAACGTATCTACTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23337
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 4709 5060 94 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 2361 2712 51 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33848005)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35528847
GRCz11 18 35503693
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAAGAGAGAGAAGGAGCTGGCCCGTAAACTGGAGTTTGATGGTCTGTA[T/A]GTAACTGAACAACCAGAAGATGACGACATCAAGGGCCAGTGGGACCGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39207
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036015 Nonsense 5050 5060 104 104
ENSDART00000138178 None None 164 None 6
ENSDART00000142757 Nonsense 2702 2712 61 61
ENSDART00000146076 None None 215 None 5

The following transcripts of ENSDARG00000023797 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33835818)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35516660
GRCz11 18 35491506
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAAAATGTACCAGGAGCGATGCTGGGACTTCTTTCCTGCTGGTGACTG[T/A]TTTAGGAAGCAGTATGAGGATCAGCTTGGCTAATTTCAACTAGCAGCCTG
Associated Phenotype:
Not determined