Busch Lab

ZMP

GABRB3

Ensembl ID:
ENSDARG00000023771
Description:
gamma-aminobutyric acid (GABA) A receptor, beta 3 [Source:HGNC Symbol;Acc:4083]
Human Orthologue:
GABRB3
Human Description:
gamma-aminobutyric acid (GABA) A receptor, beta 3 [Source:HGNC Symbol;Acc:4083]
Mouse Orthologue:
Gabrb3
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 Gene [Source:MGI Symbol;Acc:MGI:95621]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38563 Nonsense Mutation detected in F1 DNA Not yet available
sa17383 Essential Splice Site Available for shipment Available now
sa40740 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087300 Nonsense 50 532 2 11
Genomic Location (Zv9):
Chromosome 6 (position 38351631)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38423231
GRCz11 6 38420767
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAATAGTAACATCACTTCCTTTTCTGTTTTGCAGGAATGCTGTGGAT[G/T]GAAATAAAAAGCTGTTTGCAATTTATGACACAAGGTAAGTGTGTATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17383
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087300 Essential Splice Site 216 532 6 11
Genomic Location (Zv9):
Chromosome 6 (position 38405181)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38476781
GRCz11 6 38474317
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAGGYATCCATTAGATGAGCAGAATTGCACTCTGGAGATTGAGAGTTG[T/G]AAGTGTTCTCTCTCTTCACTCGTCTACAYATTTCCTGCTGCAAAGACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087300 Nonsense 527 532 11 11
Genomic Location (Zv9):
Chromosome 6 (position 38442747)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38514347
GRCz11 6 38511883
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACGGATTATATTTCCCGCAGTTTTCTCGCTTTTCAACTTGATCTATTG[G/A]CTGTATTATGTGAATTAGGCCTCAGGCGTCCGTTGGGTTTTTTTGGCCCT
Associated Phenotype:
Not determined