Busch Lab

ZMP

zgc:73226

Ensembl ID:
ENSDARG00000023759
ZFIN ID:
ZDB-GENE-050703-8
Description:
Bcl-2/adenovirus E1B 19kD interaction protein XR [Source:RefSeq peptide;Acc:NP_991133]
Human Orthologues:
AL139023.1, BNIP3, BNIP3L
Human Descriptions:
BCL2/adenovirus E1B 19kDa interacting protein 3 [Source:HGNC Symbol;Acc:1084]
BCL2/adenovirus E1B 19kDa interacting protein 3-like [Source:HGNC Symbol;Acc:1085]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JG85]
Mouse Orthologues:
Bnip3, Bnip3l
Mouse Descriptions:
BCL2/adenovirus E1B interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:109326]
BCL2/adenovirus E1B interacting protein 3-like Gene [Source:MGI Symbol;Acc:MGI:1332659]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40356 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26395
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031775 Essential Splice Site 15 187 1 6
Genomic Location (Zv9):
Chromosome 5 (position 6270868)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5886611
GRCz11 5 6377766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCGCCATGGCTCTGTCAGGATCTCAATCACCGGATGATGCTTTACACGG[T/C]AAGACAACCGCATGCTTCTACATCTTTACATAATAACATTGTTTAACTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26394
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031775 Nonsense 37 187 2 6
Genomic Location (Zv9):
Chromosome 5 (position 6266924)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5882667
GRCz11 5 6373822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGGGTCTGGTGGCCTCGGCGAATCAAACAGAAGGAGAATCAGGAGCT[C/T]AAGGCACCACGGCCTCCGTCCTGCAGGGGGAGCTGGAGCGTATCCTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40356
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031775 Nonsense 70 187 3 6
Genomic Location (Zv9):
Chromosome 5 (position 6259466)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 5875209
GRCz11 5 6366364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATTAATTGCCTTTTATATTGATTTCCCTCTTTGATTTCAGTCCTCCA[C/T]AGGTCGTGACCCCCAGAACATCTGGATCTCCTAAACCAGGCAGTGAGGGC
Associated Phenotype:
Not determined