Busch Lab

ZMP

spon1b

Ensembl ID:
ENSDARG00000023694
ZFIN ID:
ZDB-GENE-000427-10
Description:
spondin 1b [Source:RefSeq peptide;Acc:NP_571592]
Human Orthologue:
SPON1
Human Description:
spondin 1, extracellular matrix protein [Source:HGNC Symbol;Acc:11252]
Mouse Orthologue:
Spon1
Mouse Description:
spondin 1, (f-spondin) extracellular matrix protein Gene [Source:MGI Symbol;Acc:MGI:2385287]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38031 Nonsense Mutation detected in F1 DNA Not yet available
sa38032 Nonsense Mutation detected in F1 DNA Not yet available
sa6129 Essential Splice Site, Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38031
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031828 Nonsense 306 804 8 16
ENSDART00000137375 Nonsense 269 766 8 16
Genomic Location (Zv9):
Chromosome 25 (position 16126254)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15672798
GRCz11 25 15769198
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATTTCAGTCGCGCCGCCCCATCAGCTGAGTTTTCGGTGGATCGAGTC[C/T]GACACCTGATGTCCTTTTTGACCATGCTGGGCCCCAGTCCTGACTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38032
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031828 Nonsense 563 804 13 16
ENSDART00000137375 Nonsense 526 766 13 16
Genomic Location (Zv9):
Chromosome 25 (position 16146569)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15693113
GRCz11 25 15789513
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTGTGTTTTAGCACCCAGTAGCTGTGTGGTGACGGAGTGGGGCGAGT[G/A]GGAGCCCTGTAGTGTAAGCTGTGGTTTGGGCATGAGGAGGAGAGAACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6129
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031828 Splice Site 750 804 16 16
ENSDART00000137375 Essential Splice Site 713 766 None 16
Genomic Location (Zv9):
Chromosome 25 (position 16156743)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15703287
GRCz11 25 15799687
KASP Assay ID:
554-3708.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTCATGTGTACTTGARCCCAACTTSATTTTCTTTTACTCTCTTTCAGT[A/G]GTCTGTCCRATACGCCCTTGGTCCAGCTGGACGGAGTGTACTAAACCATG
Associated Phenotype:
Not determined