Busch Lab

ZMP

sh3gl2

Ensembl ID:
ENSDARG00000023600
ZFIN ID:
ZDB-GENE-040121-3
Description:
endophilin-A1 [Source:RefSeq peptide;Acc:NP_957410]
Human Orthologue:
SH3GL2
Human Description:
SH3-domain GRB2-like 2 [Source:HGNC Symbol;Acc:10831]
Mouse Orthologue:
Sh3gl2
Mouse Description:
SH3-domain GRB2-like 2 Gene [Source:MGI Symbol;Acc:MGI:700009]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19508 Nonsense Available for shipment Available now
sa12612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19508
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090611 Nonsense 170 347 6 9
Genomic Location (Zv9):
Chromosome 1 (position 25715161)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26055378
GRCz11 1 26749092
KASP Assay ID:
2259-0639.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACAGCATCACCTGAAGAAGCTGGAGGGGCGACGATTGGACTTTGACTA[T/A]AAGAAGAAAAGGCAAGGAAAAGTCACAGAGGATGAGATCAAACAGGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12612
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090611 Nonsense 211 347 7 9
Genomic Location (Zv9):
Chromosome 1 (position 25714192)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26054409
GRCz11 1 26748123
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTCATGTGTTACAGTTAWTAATGTTCTAACTGTGTTTCACCAGATTGAG[C/T]AAGTGAGTCAGCTTTCTGCTCTGGTCCAAGCTCAAGTCAACTACCATAGA
Associated Phenotype:
Not determined