Busch Lab

ZMP

ftr64

Ensembl ID:
ENSDARG00000023597
ZFIN IDs:
ZDB-GENE-090508-8, ZDB-GENE-090508-8
Description:
FinTRIM family protein [Source:UniProtKB/TrEMBL;Acc:B5WXY5]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40578 Nonsense Mutation detected in F1 DNA Not yet available
sa12729 Nonsense Available for shipment Available now
sa25315 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa2248 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa40578
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035360 Nonsense 177 486 3 6
ENSDART00000111921 None None 102 None 2
Genomic Location (Zv9):
Chromosome 5 (position 62736707)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70709032
GRCz11 4 71979392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGCTCTCAGCACAGACAGCGGTGGAGGACAGTGGCAAGATCTTCACT[G/T]AGCTGATCCTCTACATTGAGAGAAGACGCTCAGAGTTCACACAGCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12729
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035360 Nonsense 230 486 3 6
ENSDART00000111921 None None 102 None 2
Genomic Location (Zv9):
Chromosome 5 (position 62736866)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70708873
GRCz11 4 71979233
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGAGGTTGATGAAATGAAAAGGAGAGACTCTGAGATGAAGCAGCTTTTA[C/T]AAACAGACGATCACATATACTTCYTGCAGGTAGCTTCTCTTAAAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035360 Nonsense 341 486 6 6
ENSDART00000111921 Splice Site None 102 None 2
Genomic Location (Zv9):
Chromosome 5 (position 62740691)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70705048
GRCz11 4 71975408
KASP Assay ID:
554-7354.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAACGCCTTCGCCTGTCTGAAGGAAACAAACAGGCCTTCGACAGCGGCT[C/A]AGTCCAGCCGTATCCCGATCATCCAGACAGATTTGATCAGCACCTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2248
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035360 Nonsense 374 486 6 6
ENSDART00000111921 None None 102 None 2
Genomic Location (Zv9):
Chromosome 5 (position 62740790)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 70704949
GRCz11 4 71975309
KASP Assay ID:
554-3309.1 (used for ordering genotyping assays)
KASP Sequence:
GCTGCTGAGCAGAGAGAGTGTGTGCGGACGCTGCTACTGGGAGCTSGACT[G/A]GAGCGGMAGTGGCGGACTCGCCGTTTCAGTGGCGTACAAGAGCATCAGGA
Associated Phenotype:
Not determined