Busch Lab

ZMP

lpp

Ensembl ID:
ENSDARG00000023578
ZFIN ID:
ZDB-GENE-040426-918
Description:
lipoma-preferred partner homolog [Source:RefSeq peptide;Acc:NP_957492]
Human Orthologue:
LPP
Human Description:
LIM domain containing preferred translocation partner in lipoma [Source:HGNC Symbol;Acc:6679]
Mouse Orthologue:
Lpp
Mouse Description:
LIM domain containing preferred translocation partner in lipoma Gene [Source:MGI Symbol;Acc:MGI:2441

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa26756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26756
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031253 Nonsense 133 556 5 11
ENSDART00000126203 Nonsense 133 556 3 9
ENSDART00000136898 None None 142 None 3
ENSDART00000146876 Nonsense 133 330 5 6
Genomic Location (Zv9):
Chromosome 6 (position 28219377)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28515020
GRCz11 6 28505581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGATTCGCTGACCAGTATCCTGGCTGACCTAGAGAGCAGTTCACCTTA[T/G]AAACCGCGCACACAGCAGGTATGGTCATTACAAACACATATGCAACCACG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3577
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031253 Nonsense 231 556 6 11
ENSDART00000126203 Nonsense 231 556 4 9
ENSDART00000136898 None None 142 None 3
ENSDART00000146876 Nonsense 231 330 6 6
Genomic Location (Zv9):
Chromosome 6 (position 28275957)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28571600
GRCz11 6 28562161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCCACCTTYAATGTTCAGGTSAGGGCTGCTCAGCCTGCCCCTCAGCAG[C/T]AACCRGTGCGTGGTCCAGGACAGGTACAGTACATGCCGGCTCAACCCAGA
Associated Phenotype:
Not determined