Busch Lab

ZMP

ahr1b

Ensembl ID:
ENSDARG00000023537
ZFIN ID:
ZDB-GENE-050922-1
Description:
aryl hydrocarbon receptor [Source:RefSeq peptide;Acc:NP_001019987]
Human Orthologue:
AHR
Human Description:
aryl hydrocarbon receptor [Source:HGNC Symbol;Acc:348]
Mouse Orthologue:
Ahr
Mouse Description:
aryl-hydrocarbon receptor Gene [Source:MGI Symbol;Acc:MGI:105043]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32390 Essential Splice Site Available for shipment Available now
sa37460 Essential Splice Site Available for shipment Available now
sa37459 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa188 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa32390
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Essential Splice Site 232 940 6 11
Genomic Location (Zv9):
Chromosome 22 (position 13126176)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12962106
GRCz11 22 12986883
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTGTGTGTCGTTTCCGATGCCTCCTAGACAATTCCTCAGGATTCCTG[G/T]TCAGTGTCAACAAGCTATGCTAAGCTAAAGTATCCATTTTGCTATTAACT
Long Flanking Sequence:
TAGGTAGTGAGAGCATAAGAGAAGAAGTATGTGTTTTGTGGTTTGACCTTTAGTGGAAACTCCTGGAGTTGCAAAATAATTGTTATGGTCACTAAAATGTCTATTTTAATTAAGCATAACAGCAAACAGAAATGATGGTCAGTGGATAATTCATCTTCGTCTTCTGAAGGGCAAGTTATTTGTTATAGAAGTCCCACTGTGACTTTTCCAACCACAGCAAATTCCATTTTTCTTTTTGATATTTGTCCCCTCTTGATATTTGTTCACATCTTTGAATGGAAACACAGCTAATGAGCCATTGTTGAAAAAAAATCAAGACATGCTACCAATGTCTGCTTTCTCTCTTCTTCTGTTTTCTTTTCCTAGATGGAGATCCTGCCCCAAATATGTCTCTTGTGTTGTGCAACCCAGACCAGCTGCCTCCCGAAAACTCTTCTTTCCTGGAAAGAAACTTTGTGTGTCGTTTCCGATGCCTCCTAGACAATTCCTCAGGATTCCTG[G/T]TCAGTGTCAACAAGCTATGCTAAGCTAAAGTATCCATTTTGCTATTAACTGCCAACAAAGTTGCCTACTTAGGAATGTCATACATTTGACTGATTTGATATTACAATGGGTTGAAATATATCTGGCTATTCAGAGTCCCTAAGCCCTAACGTTCCAGATTACAGAACGAGTTAGCATCTGGGTTAGTGCAGGTTAGCGGATTGTAGCCATAGATTTGAGAATTGTTGGAACACCTCTGTAATCCCTCTTAAAGGAGCAATAAGGTCATGGGGAAAAGGTTTTAATTTGTGCTTGAAGAAACACATGAAAATGGTGAGAAGAATGAGACGTTAAGCTATCATTTCAAATTAGCCAGGTTAGCCTAAAATCAAAGCTAATTGGAGGAAAGTCAGGCTTCAGCTATAGAAACAACAGTGAATACTGATGTTTCCAGCAGGCTTTGTTCCTAAAGTATTCCTTTTCCCCACAAGTCTCTTTCTGTGCTAATCTTGGCATTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37460
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Essential Splice Site 233 940 7 11
Genomic Location (Zv9):
Chromosome 22 (position 13124787)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12960717
GRCz11 22 12985494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTTTTGTATATTGATATTCCAGTAATTGTTTGTACTTGTATTCTTGA[A/T]GGCTTTGAATTTTCAAGGACGTCTGAAATTCCTGCATGGGCAAAACAGGC
Long Flanking Sequence:
ATGAAATCTAATGCTAATTTGTGTGTTTGTGTACAAGTATGTGTGTCAGTGGTTTAATATGCCGTGAAGTCATTGACAAACTGAGACATTTGTTGTGTGGCCTTACATAAGTAGAACTATTTTAAACAGGCCTTGCACAAGGCGCCATGTAATTCCACATATGACACACTCTGACTAGCTTGCACTGCGTTTGTTAATAGATGACCTGACATGAGCTCTGTGGCCCACATTGAGTCAGAGACAAATGATGTGGTTTGCCAAAAGCACAGAAACAAAATCATCAGCTCCAGCTGTATATGTATTTATTCTACGTGTATCAGTTGTGTACGTCTTTCATGCAAATGTATTGACATGTATTTTATTTGCTCCTTTTGTTAGAGTTGCCAAGATTTACGTTTATTTAAATTTACAGTCCAAATAAACTCTGGTTTGGAATTGCTTTCAATGCTTTCCTTTTTGTATATTGATATTCCAGTAATTGTTTGTACTTGTATTCTTGA[A/T]GGCTTTGAATTTTCAAGGACGTCTGAAATTCCTGCATGGGCAAAACAGGCGATTGGATGATGGAGGCCAAATGCCACCCCAGCTTGCCCTGTTTGCCATTGCGACGCCCCTACAGCCTCCTTCCATAATGGAGATTCGAACCAAGAACATGATATTCAGAACCAAACACAAGTTGGATTTCACCCCAATGGCCTGCGATGCAAAGTAATCATGGACGACTGTGTTGATTAAAACAATAAGACGTTATATATGTTCATCTGTACAATATAATATGGTACAAACATCAGCGATGTTGTTCTGCCTGTTTTTTAGGGGTAAAATAGTTCTTGGCTACACAGAGGCGGAACTGCGAGTTCGAGGTTCAGGGTACCAGTTCATCCATGCAGCTGATATGCTCTACTGTGCTGAGAACCATGTCAGGAGTAAGATTTTCAGATTTCTTATTAAAGGTGTTAAATGTTTTAAAGTTGCCCACTTTAGACTACTTCCATAAATCGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37459
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Essential Splice Site 300 940 8 11
Genomic Location (Zv9):
Chromosome 22 (position 13124476)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12960406
GRCz11 22 12985183
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAATATAATATGGTACAAACATCAGCGATGTTGTTCTGCCTGTTTTTT[A/C]GGGGTAAAATAGTTCTTGGCTACACAGAGGCGGAACTGCGAGTTCGAGGT
Long Flanking Sequence:
GTGTATCAGTTGTGTACGTCTTTCATGCAAATGTATTGACATGTATTTTATTTGCTCCTTTTGTTAGAGTTGCCAAGATTTACGTTTATTTAAATTTACAGTCCAAATAAACTCTGGTTTGGAATTGCTTTCAATGCTTTCCTTTTTGTATATTGATATTCCAGTAATTGTTTGTACTTGTATTCTTGAAGGCTTTGAATTTTCAAGGACGTCTGAAATTCCTGCATGGGCAAAACAGGCGATTGGATGATGGAGGCCAAATGCCACCCCAGCTTGCCCTGTTTGCCATTGCGACGCCCCTACAGCCTCCTTCCATAATGGAGATTCGAACCAAGAACATGATATTCAGAACCAAACACAAGTTGGATTTCACCCCAATGGCCTGCGATGCAAAGTAATCATGGACGACTGTGTTGATTAAAACAATAAGACGTTATATATGTTCATCTGTACAATATAATATGGTACAAACATCAGCGATGTTGTTCTGCCTGTTTTTT[A/C]GGGGTAAAATAGTTCTTGGCTACACAGAGGCGGAACTGCGAGTTCGAGGTTCAGGGTACCAGTTCATCCATGCAGCTGATATGCTCTACTGTGCTGAGAACCATGTCAGGAGTAAGATTTTCAGATTTCTTATTAAAGGTGTTAAATGTTTTAAAGTTGCCCACTTTAGACTACTTCCATAAATCGTCAAAATCCCATTTGACGCTATTACATTTGTAGTGTAGAAGCTATTATTGTTCAAATAGCCACAAAAGGCCACCCACTATCAACATACTGACCTAAAACATTAAGAAAGTGTACCAGTACTAGGTTTTCGTACTTTGCTGTGTTGTTCCAAAATTCCTGGATTACGATCAAAACCATAGCTGCCATCCATAGTCTTTTGTTTGTTAGCTTTCCTGCTTGCCTGTAAGTTGCGTAACATGGAGACATTCATTCAGTAGCACTTACGCACAGTGAATGTTTCCGAGAAAATTATGTGAAACAGGGTGAGAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa188
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Nonsense 368 940 9 11
Genomic Location (Zv9):
Chromosome 22 (position 13123409)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12959339
GRCz11 22 12984116
KASP Assay ID:
554-1011.1 (used for ordering genotyping assays)
KASP Sequence:
ACAAAGGACAACCGTTGGAAATGGGTACAAGCTAATGCTAGACTTGTCTA[C/A]AAAAATGGCAAGCCTGACTACATCATTGCCACCCAGAGGCCACTTGTGTA
Long Flanking Sequence:
ACATTGGACTTTTTTGGCAAAAAAAAAACATTAGCCCTGTTCATTTTGGCAAATAATGTCAGTTTTCTCATTCAGTGTGGTTAGCAGGAGGCAATCCATAGATGTTATAGGAAAAAAGTACATTGCTTATAATGTCAGAAAGGAGACAGACAGATGAGCTAAACACAGGAGAAGGAATTCTTTCCTGTAATCCTATAGATTATGGATGAGATTGGATAAATCCTTGATGTTATGACTAGAGAAGACATGTGAACTAGAGCAGTAAATCCATATCAGTAATTTAATATGGAACCAAAAGCCCGTAGCAGAAAAAAAGGTACAATGCAAAAAAAAATAAAAATAAAAAACTGTTCTATATATTTAAGTCAATAAATGTGATTACAAATTGTTGCATTGTCCATTGCAGTGATCAAGACTGGAGAGAGTGGTCTGACTGTTTTTAGACTGCTTACAAAGGACAACCGTTGGAAATGGGTACAAGCTAATGCTAGACTTGTCTA[C/A]AAAAATGGCAAGCCTGACTACATCATTGCCACCCAGAGGCCACTTGTGTAAGTATATCATCCTACTGTCTTACATTCTTTACGTAGCTTTGCAATTTAGCTTGATTTTGATGAAAGACATTTCTTTTATTTGTTCATACAGAGAAGAAGAGGGTGGAGAGCACTTGAGGAAACGATCTATGCATCTTCCATTCACCTTTGCTACTGGAGAAGCTCTGCTGTACCAAATCAACTACCCCATGTTGGGCTTCCCCGACACCCTTCAGGACAAAGGCAAGAACAACAAAACCAAAAAGAGCAAGGTGAACAAAAGCTCAAAGGACGATCTGGATCCAAGTTCCTTACTGGGAGCCATGATGAGACAGGACGAGTCTGTTTATGTTTGCCAGCCAGCTATGGAGCCTAGAATGTCATTCCACAGTAGCCTCTTTGGTGAGCAAGGAGAGACTAGCACTTTCTCTTCTTCTGCTGAGAATGAAAGTTGGAATCCAGTGCAGAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa324
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028787 Nonsense 432 940 10 11
Genomic Location (Zv9):
Chromosome 22 (position 13123125)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12959055
GRCz11 22 12983832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCCATGTTGGGCTTCCCCGACACCCTTCAGGACAAAGGCAAGAACAAC[A/T]AAACCAAAAAGAGCAAGGTGAACAAAAGCTCAAAGGACGATCTGGATCCA
Long Flanking Sequence:
TATGGAACCAAAAGCCCGTAGCAGAAAAAAAGGTACAATGCAAAAAAAAATAAAAATAAAAAACTGTTCTATATATTTAAGTCAATAAATGTGATTACAAATTGTTGCATTGTCCATTGCAGTGATCAAGACTGGAGAGAGTGGTCTGACTGTTTTTAGACTGCTTACAAAGGACAACCGTTGGAAATGGGTACAAGCTAATGCTAGACTTGTCTACAAAAATGGCAAGCCTGACTACATCATTGCCACCCAGAGGCCACTTGTGTAAGTATATCATCCTACTGTCTTACATTCTTTACGTAGCTTTGCAATTTAGCTTGATTTTGATGAAAGACATTTCTTTTATTTGTTCATACAGAGAAGAAGAGGGTGGAGAGCACTTGAGGAAACGATCTATGCATCTTCCATTCACCTTTGCTACTGGAGAAGCTCTGCTGTACCAAATCAACTACCCCATGTTGGGCTTCCCCGACACCCTTCAGGACAAAGGCAAGAACAAC[A/T]AAACCAAAAAGAGCAAGGTGAACAAAAGCTCAAAGGACGATCTGGATCCAAGTTCCTTACTGGGAGCCATGATGAGACAGGACGAGTCTGTTTATGTTTGCCAGCCAGCTATGGAGCCTAGAATGTCATTCCACAGTAGCCTCTTTGGTGAGCAAGGAGAGACTAGCACTTTCTCTTCTTCTGCTGAGAATGAAAGTTGGAATCCAGTGCAGAATGGTGTAACTACAGCCTCCAAACAGGAGACGTCGAGTTTTGACCCACTTTTGGCAACATTAGACTCTCTTTCTTTGGAAAATGAGGAGAGCTGCTCCAACAGTGAGTTATTCAGTGCCCTTGAAAATCTTGGACTCAATGCAGAGGACCTTGAGTTGCTGCTTCTAGATGAAAGGATGATCCAGGTAGAAGTGGAACCGGACTTTATCCCATCTCTCAATGATCTTCTCACAAACAACGAAATCCTCTCCTACGTCCATGATTCACTGGAGAACCAGACTGAGGAC
Associated Phenotype:
Not determined