Busch Lab

ZMP

ggt1

Ensembl ID:
ENSDARG00000023526
ZFIN ID:
ZDB-GENE-040426-1388
Description:
gamma-glutamyltranspeptidase 1 [Source:RefSeq peptide;Acc:NP_956709]
Human Orthologues:
GGT1, GGT2, GGTLC1, GGTLC2, GGTLC3
Human Descriptions:
gamma-glutamyltransferase 1 [Source:HGNC Symbol;Acc:4250]
gamma-glutamyltransferase 2 [Source:HGNC Symbol;Acc:4251]
gamma-glutamyltransferase light chain 1 [Source:HGNC Symbol;Acc:16437]
gamma-glutamyltransferase light chain 2 [Source:HGNC Symbol;Acc:18596]
gamma-glutamyltransferase light chain 3 [Source:HGNC Symbol;Acc:33426]
Mouse Orthologue:
Ggt1
Mouse Description:
gamma-glutamyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:95706]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27250
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036280 None None 489 None 13
ENSDART00000141455 Essential Splice Site None 579 1 14
Genomic Location (Zv9):
Chromosome 8 (position 42028516)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40042096
GRCz11 8 40075870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGTTCGGGTGTGTTTCATCTGGGTGGTCCGATTTGTAGGTGAACTGG[G/A]TAAGCTAAATTGTCTGTAGTGTATGAGTGTGTGTGTGAATGAATTTTTCC
Long Flanking Sequence:
GGTTTATTCACCCAGTTACACTCCCTGTGACAAGGCACCCCTTTACGATTGTAGTGTGCTTAAAAACTGCTCTTAAGCTCTAAAAACTGGTCATGCACATCCGTCAAGTGCATGTTTACATTGGAAACAACAGAATGTAGTGGATTGTAATATTAAAATCTGTTCTGTGTGAATGAGCCCTTACTGTGGCTGTTGTGTGTAGTTGTCAGGAAGGACCAAGTGTTCTGTCTACATCATAATGAACTGTTTAAACTGTAGTTGTTAAGAATGAGTTAATAATACTGTGCCCCTCCAGGTAAAGTCATGACATAATGATACATTAACAGATCATGGGTACATGTTGGTCAAATTGCGTTTTAATGAACATTGTTTTTCATAGAGTGAGTTGGTTGCTGGTTCAAGTACAGGCTGGGCCAGTTGGCATTTCTGTGTGGAGTCTGCATGTTCTCCCTGTGTTCGGGTGTGTTTCATCTGGGTGGTCCGATTTGTAGGTGAACTGG[G/A]TAAGCTAAATTGTCTGTAGTGTATGAGTGTGTGTGTGAATGAATTTTTCCCAGTATTTGGTTGTGGCTGGAAGGGTATCCGCTCCATTAAATATATGCTGTAATATTTGGTGGTTCATTCCGCTGTGGCAACTCCTGAAATAGAGGCTAAGCCAAAGGAAAATTAATAAATAAAGTGTTAATTAAGAGATTAATTACCAAACATGTACTAACAAGTAATTCATTATTCACACATGAACTCAAGTGACTCATGTTGTGGTTAAAGTTAGTTTTAACTTATGATTAGTCCATAACAAAGTAACATTTAGTTTACATATTAGTATATCGTAATCTTTATACTGTTACTGTAAAGTATTAACTAATTAAGCATTAAGTGTTAAAATAGATATTATTATTACAACCAAATAAAAACATTAAAAATCAAGCCAAAGAGCCCAAGTAAGCAAACCCTGCTTTCCACAATGGTGAAAAAAAATGTTTTCTGTTATATGAAATATGCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1835
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036280 Nonsense 457 489 13 13
ENSDART00000141455 Nonsense 547 579 14 14
Genomic Location (Zv9):
Chromosome 8 (position 41995626)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 40009206
GRCz11 8 40042980
KASP Assay ID:
554-1826.1 (used for ordering genotyping assays)
KASP Sequence:
TAYAGAGTGTTCTTGATGGCTTGGAACAGAAGAATCACGTAACAGAGCTA[C/T]AGAGGACACCAGGTGCAGTGGTCCAGGCCATCGTGCGGCAAGGRGACAAA
Long Flanking Sequence:
TTCATTAATATAACAAATGTATCTAAAAGTAATTAATTGTTCACAGTATTTTAAAGTGCCCACAATATCAATAGACTGTATGTTCATTAACACAATATATAGTGTATTTAAGTGTAACTTAAATGGCCACTTCGAATGGCCCTTTAGATTAAAAGATTCCAAAGGTTACAACTGAAGGTGACTCTTAAAGCCCCCGCGATCCTTTGCACAGGGAAGTTGTTTGGTGTTGCACACTGCGGAAGGGATCATCTCTATGGCCTAATCCCTTTAAAGCTGTCACCCCAGAGGGTAAACCCTTCAAAGGGATTAGGGTGTAAGGATGAGCCCTTCCAAATAGAACACAGTGGATGTGTGTAGTCTAAACCCAGCAAGATAAGATAAGCATATAATTCAATTACATATTATTTTTTTTTAATGTGTGTGTGTGATTGTAACCATCTCCATACCTACTATAGAGTGTTCTTGATGGCTTGGAACAGAAGAATCACGTAACAGAGCTA[C/T]AGAGGACACCAGGTGCAGTGGTCCAGGCCATCGTGCGGCAAGGGGACAAACTCTGTGCTGAATGTGACCCCAGGAAAGGCGGCTATCCTGCAGGATACTGAACGCCAGTCCATCTCACCATTCGTGGACCTTCAGAGACTCAGTCGTGAAAAATGGATACATTCAGAAGCAACAGACCTTTCAGGCTAATGATCAACATGGACCACAATGCACAAAGTTGCACAAAGACTCCCTGTATTTATTATTTATTTTATTTTATTTTGTTGATGGGGAAATGTTTCTTTGATATTTATGATTTTACCAAGCTTATTTATTCCTTTTGTGTGTAGAAAAGATGATTTATTATCAGGGGTCTTTTTGGTGCCTGATTCTATTGTACGGGTTCTTTGTTTGTGTAATGAAGTTCCTGGGGGTTTCATGTTGAAAATCTTCAAAGCTCATATTAACACAAAACATGTCTGTAAATGTGACCAAGTCAGGGTACATAACCGTACAAATAA
Associated Phenotype:
Not determined