Busch Lab

ZMP

ctage5

Ensembl ID:
ENSDARG00000023516
ZFIN ID:
ZDB-GENE-040426-872
Description:
CTAGE family, member 5 [Source:RefSeq peptide;Acc:NP_956605]
Human Orthologues:
CTAGE1, CTAGE4, CTAGE5, CTAGE8, CTAGE9
Human Descriptions:
CTAGE family, member 4 [Source:HGNC Symbol;Acc:24772]
CTAGE family, member 5 [Source:HGNC Symbol;Acc:7057]
CTAGE family, member 8 [Source:HGNC Symbol;Acc:37294]
CTAGE family, member 9 [Source:HGNC Symbol;Acc:37275]
cutaneous T-cell lymphoma-associated antigen 1 [Source:HGNC Symbol;Acc:24346]
Mouse Orthologue:
Ctage5
Mouse Description:
CTAGE family, member 5 Gene [Source:MGI Symbol;Acc:MGI:1346056]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa23018 Essential Splice Site Available for shipment Available now
sa23017 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23018
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Essential Splice Site None 691 1 25
Genomic Location (Zv9):
Chromosome 17 (position 12935658)
Other Location(s):
Assembly Chromosome Position
GRCz11 17 13072246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACATGTTGACCATATTCCTAACGTGATTGATTTTACGGATTTTATAGG[T/A]ACAAAAATCAAGCTGTCCTTGGTATTAGCTTTGTTTAACTGTTTATAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23017
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Nonsense 196 691 10 25
Genomic Location (Zv9):
Chromosome 17 (position 12930405)
Other Location(s):
Assembly Chromosome Position
GRCz11 17 13066993
KASP Assay ID:
2261-0746.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTATCATATTTTTTATTCCAGTCGCTCACAGAGTGCCTTTTGAAGATG[C/T]GAGATTGGGATTCAGAGGACGAGACCAGCATCGACGGCAGCACTAATATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19166
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Essential Splice Site 268 691 12 25
ENSDART00000028311 Essential Splice Site 268 691 12 25
Genomic Location (Zv9):
Chromosome 17 (position 12929957)
Other Location(s):
Assembly Chromosome Position
GRCz11 17 13066545
KASP Assay ID:
2261-0745.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTCGCCAAACTTGCAGATGAAATTAAAGCCAAAGAAGATCTCCATGG[T/A]AAATCATTTGCATCCACTACAATTGAAACAGGTTTTAAGATGCATGAACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4001
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028311 Essential Splice Site 268 691 12 25
ENSDART00000028311 Essential Splice Site 268 691 12 25
Genomic Location (Zv9):
Chromosome 17 (position 12929957)
Other Location(s):
Assembly Chromosome Position
GRCz11 17 13066545
KASP Assay ID:
2261-0745.1 (used for ordering genotyping assays)
KASP Sequence:
GTGTTCGCCAAACTTGCAGATGAAATTAAAGCCAAAGAAGATCTCCATGG[T/A]AAATCATYTGCATCCACTACAATTGAAACAGGTTTTAAGATGCATGAACC
Associated Phenotype:
Not determined