Busch Lab

ZMP

tjp2b

Ensembl ID:
ENSDARG00000023443
ZFIN ID:
ZDB-GENE-040718-58
Description:
tight junction protein 2b [Source:RefSeq peptide;Acc:NP_001002366]
Human Orthologue:
TJP2
Human Description:
tight junction protein 2 (zona occludens 2) [Source:HGNC Symbol;Acc:11828]
Mouse Orthologue:
Tjp2
Mouse Description:
tight junction protein 2 Gene [Source:MGI Symbol;Acc:MGI:1341872]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa41135 Nonsense Mutation detected in F1 DNA Not yet available
sa21212 Essential Splice Site Available for shipment Available now
sa34328 Nonsense Available for shipment Available now
sa34329 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41135
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739 Nonsense 196 371 6 9
ENSDART00000092355 Nonsense 214 389 4 7
ENSDART00000115057 Nonsense 239 1204 5 23
ENSDART00000136184 Nonsense 214 1179 4 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12000719)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11445482
GRCz11 8 11483187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCAGCAGGGGCCGGACGCTGGAGCGCGGGTCTAGCCCGGAGCCTCGATA[T/G]CAACGGCAGCACAGCAGAGGCCGCGGTGGAGGAAGCCCTGCTGGAAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21212
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739 None None 371 None 9
ENSDART00000092355 None None 389 None 7
ENSDART00000115057 Essential Splice Site 489 1204 9 23
ENSDART00000136184 Essential Splice Site 464 1179 8 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12021738)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11466501
GRCz11 8 11504206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGTAGAACCACAGGATGAAGAGCCACCACCACCGCCACCACCACCAC[G/A]TATGAACGTCATTTTGTAATTTCTTCATAGCTGATTGTAAAAACTGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34328
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739 None None 371 None 9
ENSDART00000092355 None None 389 None 7
ENSDART00000115057 Nonsense 1097 1204 21 23
ENSDART00000136184 Nonsense 1072 1179 20 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12057079)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11501842
GRCz11 8 11539547
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAGACCCCTCAAAGAGGTCTTTCCTGGGCAAAGTCAAGGCCTTCGAG[C/T]AGATGGATCACTTCGCCCGCTCACAGAGGGTTCTGGAGATACAAGAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34329
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018739 None None 371 None 9
ENSDART00000092355 None None 389 None 7
ENSDART00000115057 Nonsense 1135 1204 22 23
ENSDART00000136184 Nonsense 1110 1179 21 22

The following transcripts of ENSDARG00000023443 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12058396)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11503159
GRCz11 8 11540864
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAAATTGCTCAGAAACATCCAGACATATACGCTGTTCCCATGAAGTCT[C/T]AGAAACTGGACCACAGCAGGCCACAACCTATCGGGTAAGAGCCTGAAATT
Associated Phenotype:
Not determined