Busch Lab

ZMP

atg5

Ensembl ID:
ENSDARG00000023396
ZFIN ID:
ZDB-GENE-040801-149
Description:
autophagy protein 5 isoform 2 [Source:RefSeq peptide;Acc:NP_991181]
Human Orthologue:
ATG5
Human Description:
ATG5 autophagy related 5 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:589]
Mouse Orthologue:
Atg5
Mouse Description:
autophagy-related 5 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1277186]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22749 Nonsense Available for shipment Available now
sa36038 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22749
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029727 Nonsense 154 275 5 8
Genomic Location (Zv9):
Chromosome 16 (position 8605340)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7468594
GRCz11 16 7385940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAACATAAAGGCCAGGTCATCAACGATATGCAGAAGAAAGACCATAAA[C/T]AACTGTGGATGGGTCTGCAGAATGGTAAGGACAAATATTTGACAAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36038
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029727 Nonsense 168 275 6 8
Genomic Location (Zv9):
Chromosome 16 (position 8611712)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7474966
GRCz11 16 7392312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCAATTAAACCCACTTTTCTTTTTTTCAGATAAATTTGACCAGTTCTG[G/A]GCCATGAATCGCAAACTCATGGAGTATCCCACCGAAGAGGGAGGCTTTCG
Associated Phenotype:
Not determined