Busch Lab

ZMP

slc37a2

Ensembl ID:
ENSDARG00000023394
ZFIN ID:
ZDB-GENE-040426-1949
Description:
Sugar phosphate exchanger 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7SY29]
Human Orthologue:
SLC37A2
Human Description:
solute carrier family 37 (glycerol-3-phosphate transporter), member 2 [Source:HGNC Symbol;Acc:20644]
Mouse Orthologue:
Slc37a2
Mouse Description:
solute carrier family 37 (glycerol-3-phosphate transporter), member 2 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40573 Nonsense Mutation detected in F1 DNA Not yet available
sa20548 Essential Splice Site Available for shipment Available now
sa13999 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40573
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038602 Nonsense 54 494 3 19
ENSDART00000127958 Nonsense 54 490 3 18
Genomic Location (Zv9):
Chromosome 5 (position 59923640)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57787017
GRCz11 5 58457025
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGAATTGTGGTATTTATTTCTGACAGAGCCAGCTGCATAGAAACTGCT[C/A]AAATGTTGTTCATCCAGCAAATCTTAACATCACTGACAATGATACCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20548
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038602 Essential Splice Site 103 494 4 19
ENSDART00000127958 Essential Splice Site 103 490 4 18
Genomic Location (Zv9):
Chromosome 5 (position 59926143)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57789520
GRCz11 5 58459528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGGACAACTGCTTTCTGGTTGCGTATGCTGTTGGCATGTTCTTTAGG[T/C]ATGATGCTGGATACTCTTTGTAAGTTTAAATATGTTAAATGTGTTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13999
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038602 Nonsense 457 494 16 19
ENSDART00000127958 Nonsense 457 490 16 18
Genomic Location (Zv9):
Chromosome 5 (position 59945151)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57808438
GRCz11 5 58478157
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCTGTTGGCTGGTCTGATCTCTCCCACYGGCTGGAACAACGTCTTCTA[C/A]ATGCTCATTGCTGCTGAKGTACTGGCCTGTYTGGTGTGTATTATATTGAT
Associated Phenotype:
Not determined