Busch Lab

ZMP

mxd

Ensembl ID:
ENSDARG00000023369
ZFIN ID:
ZDB-GENE-030721-8
Description:
MxD protein [Source:UniProtKB/TrEMBL;Acc:Q800G6]
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa32528 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32528
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036702 Essential Splice Site 474 644 11 14
Genomic Location (Zv9):
Chromosome 25 (position 20220016)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19631993
GRCz11 25 19729944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGGCCCAACTTAAGGAGCCAGCGATCAACTTACTTCATAAAGCAAACG[G/T]TACCATCAGACATCTTTGTGTTTAAAGACTTTCTTGCAACCTTCTACAAT
Associated Phenotype:
Not determined