Busch Lab

ZMP

mapk15

Ensembl ID:
ENSDARG00000023262
ZFIN ID:
ZDB-GENE-050522-307
Description:
mitogen-activated protein kinase 15 [Source:RefSeq peptide;Acc:NP_001018581]
Human Orthologue:
MAPK15
Human Description:
mitogen-activated protein kinase 15 [Source:HGNC Symbol;Acc:24667]
Mouse Orthologue:
Mapk15
Mouse Description:
mitogen-activated protein kinase 15 Gene [Source:MGI Symbol;Acc:MGI:2652894]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29272
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039074 Nonsense 339 523 10 14
ENSDART00000097680 Nonsense 341 533 11 17
ENSDART00000132594 Nonsense 283 428 8 13
Genomic Location (Zv9):
Chromosome 19 (position 48379406)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46658200
GRCz11 19 46250455
KASP Assay ID:
2261-3746.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGCCCGTGGATGATGACGTCCAGCTCTCCGTTACACAATACAGAAAC[A/T]AACTCTATGAGGTAAGAAGAAACTTTAGGTTTGCTACTTTGGTAGCAGCC
Associated Phenotype:
Not determined