Busch Lab

ZMP

syngr1b

Ensembl ID:
ENSDARG00000023209
ZFIN ID:
ZDB-GENE-090624-2
Human Orthologue:
SYNGR1
Human Description:
synaptogyrin 1 [Source:HGNC Symbol;Acc:11498]
Mouse Orthologue:
Syngr1
Mouse Description:
synaptogyrin 1 Gene [Source:MGI Symbol;Acc:MGI:1328323]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7583 Missense Mutation detected in F1 DNA Not yet available
sa33784 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7583
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037648 Missense 45 193 2 4
Genomic Location (Zv9):
Chromosome 6 (position 317468)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149779.1 17427
GRCz11 KN149779.1 17427
KASP Assay ID:
554-4303.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTTTCTCTGGTGATTTTGGGATGTATCGCTAACGAAGGCCAAATCAAC[A/T]GGCCTGACGAGGTCCAGAAGTTTTGCATCTTCAACCGCAACCAGAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33784
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037648 Nonsense 64 193 2 4
Genomic Location (Zv9):
Chromosome 6 (position 317527)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149779.1 17486
GRCz11 KN149779.1 17486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGTCCAGAAGTTTTGCATCTTCAACCGCAACCAGAACGCCTGTAATTA[T/A]GCGCTGGGCATGGCCTCGCTGGCCTTCATCTGGTGCCTGCTGTTTCTGGC
Associated Phenotype:
Not determined