Busch Lab

ZMP

snrnp40

Ensembl ID:
ENSDARG00000023160
ZFIN ID:
ZDB-GENE-040426-978
Description:
U5 small nuclear ribonucleoprotein 40 kDa protein [Source:RefSeq peptide;Acc:NP_956616]
Human Orthologue:
SNRNP40
Human Description:
small nuclear ribonucleoprotein 40kDa (U5) [Source:HGNC Symbol;Acc:30857]
Mouse Orthologue:
Snrnp40
Mouse Description:
small nuclear ribonucleoprotein 40 (U5) Gene [Source:MGI Symbol;Acc:MGI:1913835]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14008 Essential Splice Site Available for shipment Available now
sa16628 Essential Splice Site Available for shipment Available now
sa23589 Essential Splice Site Available for shipment Available now
sa43339 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14008
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038230 Essential Splice Site 167 347 4 10
ENSDART00000038230 Essential Splice Site 167 347 4 10
Genomic Location (Zv9):
Chromosome 19 (position 44612396)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43440064
GRCz11 19 43009501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCGCGGCCCACAGCTGGCCTGCACYGGCAGCGATGACGGAACTGTGAAG[G/A]TAAATCCCAGGATTAGACTCGTAACTCTTTAGATGTCTYGAATCTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16628
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038230 Essential Splice Site 167 347 4 10
ENSDART00000038230 Essential Splice Site 167 347 4 10
Genomic Location (Zv9):
Chromosome 19 (position 44612396)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43440064
GRCz11 19 43009501
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTCGCGGCCCACAGCTGGCCTGCACYGGCAGCGATGACGGAACTGTGAAG[G/A]TAAATCCCAGGATTAGACTCGYAACTCTTTAGATGTCTYRAATCTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23589
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038230 Essential Splice Site 167 347 4 10
Genomic Location (Zv9):
Chromosome 19 (position 44612397)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43440065
GRCz11 19 43009502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCGGCCCACAGCTGGCCTGCACCGGCAGCGATGACGGAACTGTGAAGG[T/A]AAATCCCAGGATTAGACTCGTAACTCTTTAGATGTCTCGAATCTTAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43339
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038230 Essential Splice Site 208 347 5 10
Genomic Location (Zv9):
Chromosome 19 (position 44615692)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43443360
GRCz11 19 43012797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACACCAGTGACCAGATCATCTCAGGAGGAATCGACAATGACATAAAG[G/A]TCTGTGAGCTATGAACAGTCTCAAACTAATTACTAGGGCTTCATGATATT
Associated Phenotype:
Not determined