Busch Lab

ZMP

scaper

Ensembl ID:
ENSDARG00000023104
ZFIN ID:
ZDB-GENE-060303-5
Description:
S phase cyclin A-associated protein in the ER [Source:RefSeq peptide;Acc:NP_001116519]
Human Orthologue:
SCAPER
Human Description:
S-phase cyclin A-associated protein in the ER [Source:HGNC Symbol;Acc:13081]
Mouse Orthologue:
Scaper
Mouse Description:
S phase cyclin A-associated protein in the ER Gene [Source:MGI Symbol;Acc:MGI:1925976]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa3292 Nonsense F2 line generated Not yet available
sa12343 Essential Splice Site Available for shipment Available now
sa25235 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38119 Splice Site Mutation detected in F1 DNA Not yet available
sa44341 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30292
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Nonsense 282 1551 5 31
ENSDART00000103324 Nonsense 158 1318 5 30
Genomic Location (Zv9):
Chromosome 25 (position 33537208)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32147610
GRCz11 25 32558567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTGCTTGTTTTTCCCTCCCAGGAGGTGCTGATGATGTTGGATAACTA[T/A]GTGCGAGACTTCAAAGCTCTAATAGACTGGATCCAGTTGCAGGAGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3292
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Nonsense 452 1551 8 31
ENSDART00000103324 Nonsense 328 1318 8 30
Genomic Location (Zv9):
Chromosome 25 (position 33546662)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32157064
GRCz11 25 32568021
KASP Assay ID:
554-2488.1 (used for ordering genotyping assays)
KASP Sequence:
CCCAAGAYAAATCTCAGGACGTGAGGGAGCAAGAGCCACCCATACCCCAA[G/T]AGCCCAGCAAAGAGATGGAAAAGACCCCGGTCATCGAGGTAATGACGTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30293
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Essential Splice Site 573 1551 9 31
ENSDART00000103324 None None 1318 None 30
Genomic Location (Zv9):
Chromosome 25 (position 33548597)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32158999
GRCz11 25 32569956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCAGTGATGACACTGGAGAGCTTGCTGGACCCCACAGAACTTTCTACT[G/A]TGAGTGCTGAGAGACACAGGCCAGGGTCAGGGCTGCCGCCTAAACAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12343
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Essential Splice Site 953 1551 18 31
ENSDART00000103324 Essential Splice Site 720 1318 17 30
Genomic Location (Zv9):
Chromosome 25 (position 33567891)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32178293
GRCz11 25 32589250
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ARCTCACACCGTATGARCGGAAGAAGCAGTGCTCGCTCTGTAACGTTGTG[G/A]TAAGTACWGCATTATGGGATGCGTYAKGATTATATAARGAGCAGATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25235
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Essential Splice Site 1057 1551 21 31
ENSDART00000103324 Essential Splice Site 824 1318 20 30
Genomic Location (Zv9):
Chromosome 25 (position 33600018)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32210420
GRCz11 25 32621377
KASP Assay ID:
554-7761.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGCATGGAAGCCAAAAGCCAGACCTCCGACTCTCCGTACAAGGCCAAG[T/G]AAGCCCCCCCTGCTCTGCTTTTTAAGGATCATATACCCAAACAGGGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38119
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Splice Site None 1551 None 31
ENSDART00000103324 Splice Site None 1318 None 30
Genomic Location (Zv9):
Chromosome 25 (position 33601750)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32212152
GRCz11 25 32623109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAGAACTCTTGGGGAGATCTCACGAATTCTAGAAAAACAGGTTTGTT[C/A]ATCTCTCTCAGGTCTCGTTTGCGCTAGTGCGTTTTAGTTTAAAACAGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44341
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Nonsense 1272 1551 26 31
ENSDART00000103324 Nonsense 1039 1318 25 30
Genomic Location (Zv9):
Chromosome 25 (position 33663815)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32274127
GRCz11 25 32681191
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTGAACGTGGGCTTGATTGACAAGTTGTACGGCTGCTTCCTGTCCATA[C/T]AAGGGCCAATCGATGAGAGTCCCAAGATGGCTGCCTTTCTGGAGCAAGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4321
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035382 Essential Splice Site 1437 1551 28 31
ENSDART00000103324 Essential Splice Site 1204 1318 27 30
Genomic Location (Zv9):
Chromosome 25 (position 33691250)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32301562
GRCz11 25 32708626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCATCATCTGCGTCGGCTACTTCACCGTCAACCACCCCGACAACCAGG[T/G]GAGTCATCCTCATTACTGCAGCTGCKTAATATACAMGCATATTAACATGT
Associated Phenotype:
Not determined