Busch Lab

ZMP

foxo3a

Ensembl ID:
ENSDARG00000023058
ZFIN ID:
ZDB-GENE-050116-1
Description:
forkhead box O3A [Source:RefSeq peptide;Acc:NP_001009988]
Human Orthologue:
FOXO3
Human Description:
forkhead box O3 [Source:HGNC Symbol;Acc:3821]
Mouse Orthologue:
Foxo3
Mouse Description:
forkhead box O3 Gene [Source:MGI Symbol;Acc:MGI:1890081]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15218 Essential Splice Site Available for shipment Available now
sa22992 Nonsense Available for shipment Available now
sa7442 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15218
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030773 Essential Splice Site 190 643 1 2
Genomic Location (Zv9):
Chromosome 17 (position 6557981)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6636917
GRCz11 17 6794147
KASP Assay ID:
2261-0574.1 (used for ordering genotyping assays)
KASP Sequence:
GCCATACTTCAAGGACAAAGGTGACAGCAACAGCTCTGCAGGATGGAAGG[T/C]ACGTCAGGTCAAATRTTTTAACCTTGGCTTCCTTTTAACCCTTTATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22992
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030773 Nonsense 245 643 2 2
Genomic Location (Zv9):
Chromosome 17 (position 6570278)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6649214
GRCz11 17 6806444
KASP Assay ID:
2261-0575.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCTCCACGCAGGCGTGCAGTATCAATGGACAACAGTAATAAGCTCATC[A/T]AGAGCGCCCGTGGCCGTGCCGCAAAGAAGAAAGCCGCTCTGCAGGCATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2925
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030773 Nonsense 584 643 2 2
Genomic Location (Zv9):
Chromosome 17 (position 6571295)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6650231
GRCz11 17 6807461
KASP Assay ID:
554-3292.1 (used for ordering genotyping assays)
KASP Sequence:
CCTCTGCTCAGTCGGTGTCTCAGGACCGTTTCTCATCTGACTTGGATCTT[G/T]AGGCATTCAGTGGCAGTTTCGATTGCGATATGGACATCATAACYCGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7442
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030773 Missense 593 643 2 2
Genomic Location (Zv9):
Chromosome 17 (position 6571324)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6650260
GRCz11 17 6807490
KASP Assay ID:
554-4327.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTCATCTGACTTGGATCTTKAGGCATTCAGTGGCAGTTTCGATTGCGA[T/A]ATGGACATCATAACYCGCAACGATCTGATGGATGCCGAAGGCCTGGAGCT
Associated Phenotype:
Not determined