Busch Lab

ZMP

si:dkeyp-92f1.1

Ensembl ID:
ENSDARG00000023053
ZFIN ID:
ZDB-GENE-070912-688
Human Orthologue:
FAM129A
Human Description:
family with sequence similarity 129, member A [Source:HGNC Symbol;Acc:16784]
Mouse Orthologue:
Fam129a
Mouse Description:
family with sequence similarity 129, member A Gene [Source:MGI Symbol;Acc:MGI:2137237]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19741 Nonsense Available for shipment Available now
sa32908 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19741
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099690 Nonsense 218 817 6 14
ENSDART00000141315 None None 347 None 5
ENSDART00000143187 Nonsense 218 377 6 9
Genomic Location (Zv9):
Chromosome 2 (position 22769955)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23656660
GRCz11 2 23312311
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGTACGGCACATGAGGTGCAGGCTTTCCTGAAGGCCATTCACTTCTA[C/A]AGGCAGGAGAAGGGCCACTATGAATCATGGGATATGCTGGTGGGCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32908
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099690 Essential Splice Site 475 817 11 14
ENSDART00000141315 Essential Splice Site 78 347 2 5
ENSDART00000143187 None None 377 None 9
Genomic Location (Zv9):
Chromosome 2 (position 22757977)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23644682
GRCz11 2 23300333
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACAAACAGGCATCGGTTATGGAGAAAGCCAAGCTCCGCGTCCTGAAG[G/A]TTGGCCTCAGAATATATTCACCAGCAATTGAACATGATCTTAATAATAAA
Associated Phenotype:
Not determined