Busch Lab

ZMP

pkp2

Ensembl ID:
ENSDARG00000023026
ZFIN ID:
ZDB-GENE-041210-167
Description:
plakophilin-2 [Source:RefSeq peptide;Acc:NP_001106904]
Human Orthologue:
PKP2
Human Description:
plakophilin 2 [Source:HGNC Symbol;Acc:9024]
Mouse Orthologue:
Pkp2
Mouse Description:
plakophilin 2 Gene [Source:MGI Symbol;Acc:MGI:1914701]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8162
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035899 Nonsense 403 815 5 13
ENSDART00000143849 Nonsense 83 495 2 10
Genomic Location (Zv9):
Chromosome 4 (position 15785267)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16728107
GRCz11 4 16717083
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCAGTGGGCCGCCGTCAGCTCTCTCCGAAATATTGTTTTTGAAAACAAT[G/T]AGAACAAAMTGGAAGTCAAAGACTGTGAGGGGCTTCCAGTGATCYTGAGA
Associated Phenotype:
Not determined