Busch Lab

ZMP

dtl

Ensembl ID:
ENSDARG00000023002
ZFIN ID:
ZDB-GENE-020419-34
Description:
Denticleless protein homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5RHI5]
Human Orthologue:
DTL
Human Description:
denticleless homolog (Drosophila) [Source:HGNC Symbol;Acc:30288]
Mouse Orthologue:
Dtl
Mouse Description:
denticleless homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924093]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4101
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034098 Essential Splice Site 208 647 7 15
Genomic Location (Zv9):
Chromosome 20 (position 13073175)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13262421
GRCz11 20 13158401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGATTCACTCCTCAAACAAAGAAGAGACGTGGTATGGCGCCCCCTGTGG[T/A]GAGTCAGTTGATACAATTTATTTGCAGCTGTTTTTTGAAAGGYACATACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29320
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034098 Nonsense 337 647 11 15
Genomic Location (Zv9):
Chromosome 20 (position 13079976)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 13269222
GRCz11 20 13165202
KASP Assay ID:
2261-4030.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGATGACCAGTTCCTGGCTAGTGGATCCAGTGATCATAACGTTTA[C/A]ATATGGAAGGTCAGGAGTTCTCCATGCACTCACCCGCAAAATTCCCTCAT
Associated Phenotype:
Not determined