Busch Lab

ZMP

SETX

Ensembl ID:
ENSDARG00000022996
Description:
senataxin [Source:HGNC Symbol;Acc:445]
Human Orthologue:
SETX
Human Description:
senataxin [Source:HGNC Symbol;Acc:445]
Mouse Orthologue:
Setx
Mouse Description:
senataxin Gene [Source:MGI Symbol;Acc:MGI:2443480]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa32326 Nonsense Available for shipment Available now
sa11606 Nonsense Available for shipment Available now
sa37214 Nonsense Mutation detected in F1 DNA Not yet available
sa44951 Nonsense Mutation detected in F1 DNA Not yet available
sa29496 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32326
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 151 2368 3 24
Genomic Location (Zv9):
Chromosome 21 (position 4229713)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3784371
GRCz11 21 3948990
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCACAGCTGATATGGTGGTTAGGGTCTTGTACAAGTTGCAGGATTGGCAG[C/T]AAACTTTGAGTTGGTCTGAGAAGTATCAGGGAACATATCTGCTTCTCGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4168
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Essential Splice Site 341 2368 6 24
Genomic Location (Zv9):
Chromosome 21 (position 4226691)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3787393
GRCz11 21 3952012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGCCAGCTATGTGTGTGAATTAAGAAGCATCCAGCAAAAGACAATGGGG[T/C]AAGCAAGTTGTGCATTAATTAAAGGAAATTCATGGCATTCTGAAATGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11606
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 472 2368 8 24
Genomic Location (Zv9):
Chromosome 21 (position 4225983)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3788101
GRCz11 21 3952720
KASP Assay ID:
2261-5144.1 (used for ordering genotyping assays)
KASP Sequence:
AARCAAGCGTGTGTGATAAAGTGACTGAGCTCTTTGCTCGTATCTTTATT[C/T]AAATCGTTGAGCTACACTATACCGAAGGACAAATGGGAATACTTTCTCGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29497
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 638 2368 8 24
Genomic Location (Zv9):
Chromosome 21 (position 4225485)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3788599
GRCz11 21 3953218
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTACAAATACTGTTGTTTCCAGAAATTCAGTATCAATCTGCCAACAA[C/T]AAGAGGACCCGGAGGCAGGTCCCAGCAGAGCTGCGTTTATCAAAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37214
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 882 2368 8 24
Genomic Location (Zv9):
Chromosome 21 (position 4224752)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3789332
GRCz11 21 3953951
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAATATGTGGCATCTGCTTGGGATAATGCAGATTTGGATGGATCAGTCT[T/A]GACAAAGAATCTCAAATCAGATCGAATACTCAAGCCACAGTTGGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44951
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Nonsense 1399 2368 8 24
Genomic Location (Zv9):
Chromosome 21 (position 4223201)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3790883
GRCz11 21 3955502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTCCCCCTCCTGCAAATGTCGCTAAAGCAAAAATTCCTCGATTGGCTT[C/A]AGCAATGCCACCCCCAGCAATGCCACCACCAAAAATGCCACCCCCCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29496
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082314 Essential Splice Site 1764 2368 12 24
Genomic Location (Zv9):
Chromosome 21 (position 4220559)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3793525
GRCz11 21 3958144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAAGAGTAAAACAATTGGTGGTCTGTTGTACAAACTTCTGTCTTCGG[T/C]ACTTATTTTCCCATCTGAATGCATCTTTATTTCTCCATACTCTGCATGCT
Associated Phenotype:
Not determined