Busch Lab

ZMP

si:ch211-241e1.3

Ensembl ID:
ENSDARG00000022615
ZFIN ID:
ZDB-GENE-030131-230
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZG5]
Human Orthologue:
LAMA3
Human Description:
laminin, alpha 3 [Source:HGNC Symbol;Acc:6483]
Mouse Orthologue:
Lama3
Mouse Description:
laminin, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:99909]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa19647 Essential Splice Site Available for shipment Available now
sa32820 Nonsense Mutation detected in F1 DNA Not yet available
sa13307 Nonsense Available for shipment Available now
sa1076 Essential Splice Site F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25729
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Essential Splice Site 143 1368 2 31
ENSDART00000140540 Essential Splice Site 122 1347 2 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1167055)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1112876
GRCz11 2 983284
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTAACGGACACTCAAATGAGTGCGAGGAAAACACCGGACGATGTCTAG[T/A]AAGTGAACATTGATCATACTAATCTGCTCTGGTTTCACATTGTTTTTAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5117
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Nonsense 552 1368 13 31
ENSDART00000140540 Nonsense 531 1347 13 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1153913)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1099734
GRCz11 2 970142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAATGAAATCRTCTGTGTTTCCTGCAGGAGTATGAACAGCTTGCAGCA[C/T]AACTGAACGGAGCAAAGACTGACCTGAAGAAGAAACTCCAGACCGTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19647
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Essential Splice Site 644 1368 15 31
ENSDART00000140540 Essential Splice Site 623 1347 15 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1149327)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1095148
GRCz11 2 965556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTTAAGTGCTTACACATTTGTATTTCTTTTTTTGTTCTGTTGTTTCA[G/A]GATGTCAGTCAAGGGGATTTAATCAACAGAGCACAAGATCTGAAAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32820
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Nonsense 1016 1368 22 31
ENSDART00000140540 Nonsense 995 1347 22 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1138744)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1084565
GRCz11 2 954973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGCTGCATTGAGTTTTCCACCTTCAATGAAAAATTCCTCAGTCTGTA[C/A]AACTTTAAGAACGCCGTCAATATTAACCTGGAAACTCCTTGTAAGAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13307
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Nonsense 1156 1368 25 31
ENSDART00000140540 Nonsense 1135 1347 25 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1136536)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1082357
GRCz11 2 952765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGACCACCGAAGTCAAAAGGGACGTCAATATTCCAAGGAAATTCCTTTA[T/G]TACTACATCGGTGGAATTCCCAGCATTTTGCGTGAGAGRTTTGTATCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1076
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058281 Essential Splice Site 1169 1368 25 31
ENSDART00000140540 Essential Splice Site 1148 1347 25 31

The following transcripts of ENSDARG00000022615 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 1136497)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1082318
GRCz11 2 952726
KASP Assay ID:
554-0978.1 (used for ordering genotyping assays)
KASP Sequence:
AAATTCCTTTATTACTACATCGGTGGAATTCCCAGCATTTTGCGTGAGAG[G/A]TTTGTATCTTGGTGGCTTCCCTTTAGGATGTATATATTTTCTAAACACTC
Associated Phenotype:
Not determined