Busch Lab

ZMP

zgc:56106

Ensembl ID:
ENSDARG00000022564
ZFIN ID:
ZDB-GENE-040426-904
Description:
Small acidic protein [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVC9]
Human Orthologue:
C11orf58
Human Description:
chromosome 11 open reading frame 58 [Source:HGNC Symbol;Acc:16990]
Mouse Orthologue:
1110004F10Rik
Mouse Description:
RIKEN cDNA 1110004F10 gene Gene [Source:MGI Symbol;Acc:MGI:1929274]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36667 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36667
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028294 Essential Splice Site 68 171 3 5
Genomic Location (Zv9):
Chromosome 18 (position 27258103)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27331358
GRCz11 18 27313736
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACGCCTTGTTATTGGGGATCACAAGTCAACGTCCCATTTCCGCAGTGG[T/C]GAGTCTGTTAGAGTTTTTAGGTTTATATTTGTGTGACAAACACACAAGTG
Long Flanking Sequence:
CATGTTTTCAGTATAAAGCAGACCTATTTACCAACAAGTGCACTATATTGGTTTTTATTTGTTTATTGGAACAATAAAAATGTCGTCTTTTTTTACCCATATTTCCCTAAAATTGATCTGTTTAATAATTTATCTGTCCAATTTAATCTGTCCAATAAATTTCATGCACTCCTATTTCAAATGCAGTTTAAATACACACTTATGTCTGAAATGAATCTGTTTTTTTGATTGTTTGTTTGTTGTTGCAGACGGGATCCACACAATGGCAGTCGGCAGATTTAGGTACAGACGAACGGAAGCAGAAGTTTTTGAGGCTGATGGGAGCTGGAAAGGTGCATTTGAGTCTTATCATATGAAACAAACTGTTTTAAACAAGTCTCCATCTAATCTGAACAAGAACAACACATTCATGCTTCAAATGTTTTTATGCATTGGCAGAAAGAGCACACGGGACGCCTTGTTATTGGGGATCACAAGTCAACGTCCCATTTCCGCAGTGG[T/C]GAGTCTGTTAGAGTTTTTAGGTTTATATTTGTGTGACAAACACACAAGTGATTATTTGCAACCTTGTATTGTGTTGAATGGGACACTTCCAAATCCCTGGTTGTATGTGGACTGCATCAGATCACATCCTGTACGCCTCATATCCTTTTCCCTACAGTGATCGCTGGTTAAATAGGACATGAACTGACCTTTAAAACAAGCATTGGTAATGTCCGCTCGTTTATTGTGCACACAAGATTAGGCTACAGTGTGCTTGTAAAATATACAACAATTGCCCCGTGCAGTGTAGAAGACCATTATTTATTTATTAATTCATTTATTGAGGTAAAAAGATATTTTTTTGTCAGAAGTTTAATTTTGAAAAGGGTTTTATAGTTTATTAATATTTATTTTATAAGTTTTTAATCGAACATTTGACCTGAAGTTCTAAGTGAAGTTTCACAAACTAATTTCGAATGGAGTATGTGATATGATTTATCATGACTGCTCTCTTATCTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4044
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028294 Nonsense 83 171 4 5
Genomic Location (Zv9):
Chromosome 18 (position 27254478)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27327733
GRCz11 18 27310111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNNNAGGGGCAGAGGATCGGAGAAWGAATGCAGATCTGGAGCATCAGTAT[C/T]AGCAGAGTCTGGATGGAAAGTTATCAGGGAGGAACAGGAGGCACTGCGGT
Long Flanking Sequence:
TAGTTTAAAAAAAAATTTAAAACTGCTTTTATTCTAGCCAAAATAAAACAAATAAGACTTTTTCTAGAAGAAAAAATATCAGACATACTGTGAAAATTTCCCTGCTCTGTCAAACATCATTTAGGAAATATTTAAAAAAGAAAAAAACAAAAGGGGGCTAATAATTCTGACTTCAACTGTATATACTGTGTATGTAACTACTGTATTAATAATGTTTTATAAGTAGTTGTGTGAAAATGTTTGAAATTCTAATACGTTTTTGAAAGACACCCACATCTGTGCTTATATTTTTTTTCAAAAATATGACAACTTTTAAATAAAAATTAATCATGGGGTAATATTTTTATATTATATATATTTTAATATTTAATATCTGCCCTACATGTACATATAATACTATAGTTGTATTTTTTACTAATAATACATTGTTATATTTGTGTGTGTGTGTGTGTGTAGGGGCAGAGGATCGGAGAATGAATGCAGATCTGGAGCATCAGTAT[C/T]AGCAGAGTCTGGATGGAAAGTTATCAGGGAGGAACAGGAGGCACTGCGGTCTGGGCTTCAGTGAGGTGTGATGCCCATCAATCACATTTTCACTCCTTGGCCTACAGTATATAAAATGATACAGTGGATCTGATTTGTTTGTCCTATTCACAGCCTGATGAAGTAGCTGAGAGTCCGAACGCCGCTGTGTCTGAGACGTCCAACAGTTCAGAAAACCCCCCTGAACAAGTATCAGAAGCACAGAAAGAGGAGAAACCCCCAGCATCAGACACAGAGCTGGAGAAGCAGGAGCCGCACACACACTCAAAGGAGGACAAGAAAAAGACTCTTAAAATGGCATTCGTCAAATCCACATAGATGGCCAAGTCATTTTTATCTGTTGATGCTACAATTTCTTGATTTTTTTTTGTGTAATTCACTGAGTGACAGCACGTTTTTATTTCCTTTAAAACTGAACAAACTGTGCTTTCATTTTTAATGTAGTTCTATCTTTGCCATAT
Associated Phenotype:
Not determined