Busch Lab

ZMP

ntn1b

Ensembl ID:
ENSDARG00000022531
ZFIN ID:
ZDB-GENE-990415-168
Description:
netrin 1b [Source:RefSeq peptide;Acc:NP_571073]
Human Orthologue:
NTN1
Human Description:
netrin 1 [Source:HGNC Symbol;Acc:8029]
Mouse Orthologue:
Ntn1
Mouse Description:
netrin 1 Gene [Source:MGI Symbol;Acc:MGI:105088]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa2087 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa2087
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039482 Nonsense 529 602 6 6
Genomic Location (Zv9):
Chromosome 3 (position 25813126)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25581311
GRCz11 3 25711859
KASP Assay ID:
554-2490.1 (used for ordering genotyping assays)
KASP Sequence:
TCACCATCAACATCATATCGGTGTATAAGCAGGGTGGACACCGCATCCGC[A/T]GAGGAGACCAGCTCCTGTGGGTCAGGGCAAAAGACGTTGCCTGCAAGTGC
Associated Phenotype:
Not determined