Busch Lab

ZMP

pkd2l1

Ensembl ID:
ENSDARG00000022503
ZFIN ID:
ZDB-GENE-030616-558
Description:
Novel protein similar to human polycystic kidney disease 2-like 1 (PKD2L1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
PKD2L1
Human Description:
polycystic kidney disease 2-like 1 [Source:HGNC Symbol;Acc:9011]
Mouse Orthologue:
Pkd2l1
Mouse Description:
polycystic kidney disease 2-like 1 Gene [Source:MGI Symbol;Acc:MGI:1352448]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22300 Essential Splice Site Available for shipment Available now
sa42207 Nonsense Mutation detected in F1 DNA Not yet available
sa6303 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22300
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002415 Essential Splice Site 166 805 3 15
ENSDART00000145948 Essential Splice Site 151 790 3 15
Genomic Location (Zv9):
Chromosome 13 (position 25681546)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25327206
GRCz11 13 25457656
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACGGCATGAGCTTCTCCTCCATTGGCTGCATGAATGATGTCTGGACGG[T/C]GAGCTTGAGCTGCTTTTCTTGTTCCCTGGTAAAAAGAAAAGGCAAAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42207
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002415 Nonsense 341 805 6 15
ENSDART00000145948 Nonsense 326 790 6 15
Genomic Location (Zv9):
Chromosome 13 (position 25687072)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25332732
GRCz11 13 25463182
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAGATTAGTGGTTGAGTTTCCAGCTACCGGTGGAGCGATTCCATCCTA[T/A]CAGATCCGCACTGTGAAGCTGATTCGTTATGTCACCACCTGGGACTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6303
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002415 Essential Splice Site 673 805 12 15
ENSDART00000145948 Essential Splice Site 658 790 12 15
Genomic Location (Zv9):
Chromosome 13 (position 25692251)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25337911
GRCz11 13 25468361
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACAAGCAGGAGCAGGAGAACAWGAAGCAGGAGCTGGAGGAGAAAAGGG[T/A]AWGTTTGTTTAATTTAGCTAGTTAGWRTTGATGGATGACACTGATTTWGA
Associated Phenotype:
Not determined