Busch Lab

ZMP

nudt15

Ensembl ID:
ENSDARG00000022461
ZFIN ID:
ZDB-GENE-040625-95
Description:
nudix-type motif 15 [Source:RefSeq peptide;Acc:NP_001002107]
Human Orthologue:
NUDT15
Human Description:
nudix (nucleoside diphosphate linked moiety X)-type motif 15 [Source:HGNC Symbol;Acc:23063]
Mouse Orthologues:
Gm5519, Nudt15
Mouse Descriptions:
nudix (nucleoside diphosphate linked moiety X)-type motif 15 Gene [Source:MGI Symbol;Acc:MGI:2443366
predicted pseudogene 5519 Pseudogene [Source:MGI Symbol;Acc:MGI:3645618]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa26685 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26686
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029720 Essential Splice Site 56 155 1 3
Genomic Location (Zv9):
Chromosome 6 (position 9944581)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9798388
GRCz11 6 10033927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAGTTGGGAAAGGCACCTACCAGCTACCAGGAGGTCACATTGAATTTGG[G/T]TGAGTTTATACTATAAAGCACATCACTGTGTCCTTTTTATAATGTTTAGG
Long Flanking Sequence:
GTGCACTTTTTATTTTTAGAGTTTTCAATGTGAACGCACTTGTTAAATTATTTATACTACAAAATGGCGCAGAATAGTGCATAAGTATGCGATTTGGGACGCAGCTCTACCGTTCTGTAATGTTCAGCTCCAACCCTGATCAAACACAACTGAACCAATTAATTAGGACCTGAACAGCATTTGATAATTGCAGGCGCTTAATATGGGTTGTACCTGAAAACTGCAGAAAGGTAGATCCCCAGGAACAGGGTGGGTCATTCCTGAATTAGACAATATAGGCAGACAGTTTGCACAACTTTATAACTTCATTTGTTTCTTCACAGTTTACATACAATGTCTGAGGCAGTTGAAAATGGAAAACCCATCCTCAAGCGTCCTGGAGTGGGGCTCGCGGTTCTTGTGACAGACTCCTCCAATCCTGGATGTGTACTGTTAGGAAAAAGAAAAACCAGAGTTGGGAAAGGCACCTACCAGCTACCAGGAGGTCACATTGAATTTGG[G/T]TGAGTTTATACTATAAAGCACATCACTGTGTCCTTTTTATAATGTTTAGGCATGCCTGCTAACTTTAAGTTTACACATGCGCTAGAGCATGTATAGTACGTACACAAACATTTGAAGTGAAAATGATCAACCCTCCTGTGAAATTGTAATTTAAACAAATAAATCCCAAGTGCTGTTCAACACATTTCTAAACATAATAGTTTTAATAACTGAAGTTATTAAATAACTCTGCTCTTCTGCATACTTTGGTTTCTGCATACCTCGGTTGTAAGGAGTGATTATTTGAGTTACTGTTGCCTTCCTATCAGCTCGAACCAGTCTGGCCATTCTCCTCTGACCTCTGGCATCAACAAGGCATTTGCGCCCACAGAACCGCCGCTCACTGGATATTTTCTTTTTTTCTGACTATTCTCTGTAAACCCTAGAGATGGTTGTGCGTGAAAATCCCAGTAGATCAGCCATTTCTGAAATACTCAGACCATCCCGTCTGGCACCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26685
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029720 Nonsense 64 155 2 3
Genomic Location (Zv9):
Chromosome 6 (position 9943699)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 9797506
GRCz11 6 10033045
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCTCTTGAAATATTCGACATCATCAGAGAGAGCTGGGAGGAGTGTGCT[C/T]AGAGAGAGGCGATGGAGGAAGCCGGTATCCATCTAAAGAACATCCGCTTT
Long Flanking Sequence:
ACTGGATATTTTCTTTTTTTCTGACTATTCTCTGTAAACCCTAGAGATGGTTGTGCGTGAAAATCCCAGTAGATCAGCCATTTCTGAAATACTCAGACCATCCCGTCTGGCACCAACAGCCATGCCATGTTCAAAATCACTTAAATTACCTTTATTCCCCATTCTGATGCTCGGTTTGTATTGCAGCAAATCGTATTGACCATGTCTACATGCCTAAATGCATTGAGTTGCTGCCATGTGATTGGCTGATTAGAAATTTGTATGAATGAACAGTTGGATAGGTGTACCTAATAAAGTGGCCAGTGCGTGTACATAATACAGTGCAAAATACAATGACATACTTTTAAGACAATGTACATTTAAATACATAAATACACAATAAATATGTAAAGAAGCAAAATAGACAAGTAGTGTCTATTTAACATACTACACCTTAACATAAGTAAAGTTAGTCTCTTGAAATATTCGACATCATCAGAGAGAGCTGGGAGGAGTGTGCT[C/T]AGAGAGAGGCGATGGAGGAAGCCGGTATCCATCTAAAGAACATCCGCTTTGCACATGTCATCAACTCTATCAAATTGGAGGAAAACTACCACTACATCACGATCTTCATGCTGGGAGAAATGGACCGGTCTTACTCAGCTGAAGCAGTTAATCTGGAGCCAGAGAAAAATGAAGGTAAACCATTTCGTTGACTGCGTAGTCTGTGTCCAGATAGCCCACCCACAAATCATTCATGATAGTGATACAAATCTGTCATGTGAGACTATCCCATGTCTCACGCCAACTTGGCAGTCACCATTATGATGGGTTTTCGCAGTGTTGAGCAGATACTGATGTATTTTAAGTACAAATGTGTTGTATATTGATGCATCAGTCTAAGTTATTGATGACTTAAATTTCATGTAAGTCTCATCATTAGATAAACAGACTAATAGTTAACATTCACATATTATGAAATGTTTTCCCAGCACTGGGTTGCGGCTGGAAGGGCATCCGCTGCG
Associated Phenotype:
Not determined