Busch Lab

ZMP

LOC564283

Ensembl ID:
ENSDARG00000022415
Human Orthologues:
BX511012.1, SRSF10
Human Descriptions:
Serine/arginine-rich splicing factor 10 [Source:UniProtKB/Swiss-Prot;Acc:O75494]
serine/arginine-rich splicing factor 10 [Source:HGNC Symbol;Acc:16713]
Mouse Orthologue:
Srsf10
Mouse Description:
serine/arginine-rich splicing factor 10 Gene [Source:MGI Symbol;Acc:MGI:1333805]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28750
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035628 Essential Splice Site 37 173 2 5
Genomic Location (Zv9):
Chromosome 16 (position 56137813)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52646313
GRCz11 16 52532056
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCTGCGGACGGCAGATCGAGATACAGTTCGCTCAAGGAGACAGGAAGA[G/A]TATGCATATAAAAGAACTTAATTATAAATATATATATATATATATAGTTT
Associated Phenotype:
Not determined